Уони 13 55 характеристика: Электроды «УОНИ-13/55». Технические характеристики

Содержание

Технические характеристики и расшифровка электродов УОНИ 13/55

Электроды УОНИ 13/55 отлично подходят для дуговой сварки и некоторых деталей из углеродосодержащих и низколегированных металлов при низких температурах. Они прекрасно проявили себя при сварке сложных конструкций, которые требовалось соединить, дабы получить отличный по качеству сварной шов. Рассмотрим подробнее электроды УОНИ 13/55, их технические характеристики и другие параметры.

Расшифровка наименования

Для начала нам нужна расшифровка УОНИ 13/55. Это позволит в дальнейшем рассмотреть особенности работы таких электродов и что они могут дать. Расшифровывается такая аббревиатура следующим образом:

  1. У — универсальная;
  2. О — обмазка;
  3. Н — научного;
  4. И — института;

Это разработка отечественного института сварки, чье название и номер закрепились в обозначении. Иногда к аббревиатуре дополняется еще одна буква И, что обозначает исследовательский институт. Кстати, именно УОНИИ является правильным наименованием согласно ГОСТу, а вот на пачке может быть и УОНИ 13/55.

Технические параметры

Сварочные электроды УОНИ 13/55, характеристики которых рассматриваются в данном разделе, имеют следующие важные параметры:

  • Покрытие — основное;
  • Наплавочный коэффициент — 9,5 г/а*ч;
  • Производительность устройства — 1,4 кг в час;
  • Расход на килограмм наплавленного металла составляет 1,7 кг;
  • Временное сопротивление — 540 МПа;
  • Предел текучести — 410 МПа;
  • Относительное удлинение — 29%;
  • Ударная вязкость УОНИ — 260 Дж/см2.

Эти параметры являются основными. Также следует сказать, что химический состав данных электродов достаточно сложный, среди них углерод 0,09%, кремний 0,42% и марганец 0,83%. На сайте производителя можно также узнать варианты диаметров и силы тока при различных пространственных положениях электрода.

Особенности использования

Имеются некоторые нюансы, связанные с применением подобных устройств при сварке. Рассмотрим некоторые из них:

  1. Для сваривания требуется применять ток обратной полярности;
  2. Покрытие особое, состоит из карбонатов и фтористых образований, благодаря чему швы не имеют газов и прочих вредных примесей;
  3. Низкоуглеродистая сталь способствует значительной долговечности шва;
  4. Отсутствие органических соединений препятствует образованию влаги на устройствах;
  5. При изготовлении электродов полностью исключается образование различных неровностей, трещин и прочих дефектов.

В результате получается крепкий шов, не подвергающийся старению и потере свойств при изменении температурных режимов. Необходимо контролировать чистоту соединений, ибо появление ржавчины или масел ведет к образованию пор, и соединение в итоге получится плохим.

Условия хранения и производители

Чтобы изделия смогли сохранить основные свойства, необходимо хранить их в соответствующих помещениях. Относительная влажность на складе постоянно должна находиться на уровне 50%, температура же не выше 14 градусов, что достигается применением кондиционеров. Если условия соблюдаются, то срок годности не имеет ограничения.

Производством сварочных устройств занимаются такие компании, как ЛЭЗ, Спецэлектрод, СЗСМ, Monolit. При покупке необходимо наличие сертификата на соответствие их нормативам. Они выдаются соответствующим органом.

Прокалка электродов

В каждой упаковке должен быть сертификат качества и инструкция, подробно расписывающая процедуру прокалки. Если не соблюдать предписания, то ухудшится как качество сварных изделий, так и качественные характеристики получившегося шва. Процедуру прокаливания нужно проводить перед применением таких устройств. Если же их не использовали в течение 8 часов, то прокалку повторяют снова. Один и тот же электрод необходимо обрабатывать

не более 3 раз, а количество времени суммарно не должно быть выше 4 часов.

Для высокого качества прокалки необходимо такие устройства сначала помещать в специальные коробки и только затем — в печи. Диапазон рабочей температуры печей для прокалки составляет от 200 до 300 градусов. Только соблюдение указанных условий позволит сделать работу сварочных изделий долгой и не допускать образования разнообразных дефектов при прокалке.

Мы рассмотрели электроды УОНИ 13/55. Важной особенностью их применения является прокалка. Она позволит сварочному электроду проработать достаточно долгое время и избежать проблем с различными дефектами. При покупке таких устройств необходимо наличие сертификатов, указывающих на соответствие нормативам стандартов и технических условий. Внимательно относитесь к электродам — и они прослужат длительное время. Удачи при приобретении сварочных устройств!

Электроды УОНИ-13/55 ф 4мм (СПЕЦЭЛЕКТРОД) уп.5кг

Основное назначение сварочных электродов УОНИ 13/55

Марка сварочные электроды УОНИ 13/55 предназначена для сварки особо ответственных конструкций из углеродистых и низколегированных сталей, когда к металлу швов предъявляют повышенные требования по пластичности и ударной вязкости. Допускается сварка электродами УОНИ 13/55 во всех пространственных положениях постоянным током обратной полярности. По заключению независимых экспертов электроды УОНИ 13/55 производства СпецЭлектрод самые высококачественные из всех отечественных и зарубежных производителей сварочных электродов этого класса.

Характеристика электродов УОНИ 13/55 СпецЭлектрод

Покрытие марки электродов сварочных УОНИ 13/55 – основное.

Коэффициент наплавки УОНИ 13/55  – 9,5 г/А·ч.
Производительность наплавки электродов (для диаметра 4,0 мм) – 1,4 кг/ч.
Расход электродов УОНИ 13/55  на 1 кг наплавленного металла – 1,7 кг.

Типичные механические свойства металла шва сварочных электродов УОНИ 13/55.

Временное сопротивление электродов , МПа

Предел текучести УОНИ 13/55 , МПа

Относительное удлинение электродов , %

Ударная вязкость УОНИ 13/55  , Дж/см2

540

410

29

260

 

Типичный химический состав наплавленного металла марки сварочных электродов УОНИ13/55, СпецЭлектрод

C

Mn

Si

S

P

0,09

1,05

0,42

0,022

0,024

 

Геометрические размеры и сила тока при сварке сварочных электродов УОНИ 13/55.

Диаметр электродов, 

мм

Длина, 

мм   

Ток,  

А

Среднее количество

электродов 

в 1 кг, шт.

2,0

300

40 – 70

98

2,5

350

50 – 80

55

3,0

350

70 – 110

40

4,0

450

110 – 170

15

5,0

450

150 – 200

11


Особые свойства электродов сварочных- УОНИ 13/55 производства СпецЭлектрод.

Самая высококачественная марка электродов УОНИ-13/55 из всех российских производителей. Электроды обеспечивают получение металла шва с высокой стойкостью к образованию кристаллизационных трещин и низким содержанием водорода. Сварочные электроды УОНИ 13/55 отлично зарекомендовали себя при сварки в условиях Арктики. Электроды УОНИ-13/55 являются разработкой научно-исследовательского института НИИ-13. Расшифровывается как «Универсальная обмазка НИИ-13».

Технологические особенности сварки электродами УОНИ 13/55

Сварку электродами УОНИ-13/55 производят только на короткой длине дуги по очищенным кромкам.
Перед применением необходимо прокалить электроды при температуре  350-400°С; 1-2 ч.

Условное обозначение сварочных электродов УОНИ 13/55

Э50А-УОНИ-13/55-⌀-УД

ГОСТ 9466-75, ГОСТ 9467-75 ТУ 1272-003-48804191-2010

Е 51 4-Б20

Электроды УОНИ 13 55 4 мм Спецэлектрод — цена, описание и характеристики

Описание электродов УОНИ 13 55 4 мм

Разработаные и производимые заводом Спецэлектрод, предназначены для сварки методом ММА особо ответственных сварных конструкций из углеродистых и низколегированных сталей, когда к наплавленному металлу сформированных швов предъявляются повышенные требования по пластичности и ударной вязкости, особенно при работе в условиях пониженных температур. Производство сварочных работ данными электродами допускается во всех пространственных положениях, кроме вертикального сверху вниз, постоянным током, полярность — обратная. Электрод необходимо прокалить перед сваркой 2ч,температура 380 градусов.

Тип наплавленного металла — электроды Э50А
Классификация: Электрод плавящийся
Вид покрытия: Основной

Характеристика электродов УОНИ 13/55:

  • Коэффициент наплавки УОНИ 13/55 – 9,5 г/А·ч.
  • Производительность наплавки для электродов диаметра 4,0 мм– 1,4 кг/ч.
  • Расход электродов УОНИ 1355 на 1 кг навареного металла – 1,7 кг.

Механические свойства металла шва электродов УОНИ 13/55 .

Временное сопротивление электродов sв, МПа

Предел текучести УОНИ 13/55 sт, МПа

Относительное удлинение электродов d5, %

Ударная вязкость УОНИ 13/55  aн, Дж/см2

540

410

29

260

 

Химический состав наплавленного металла электродов УОНИ13/55, %

C

Mn

Si

S

P

0,09

0,83

0,42

0,022

0,024

ЛЭЗ УОНИ-13/55 — ООО ПК ЛЭЗ Электроды для сварки, производство сварочных электродов

ЛЭЗ УОНИ-13/55

Тип Э50А

Электроды марки ЛЭЗ УОНИ-13/55 предназначены для ручной дуговой сварки особо ответственных конструкций из углеродистых и низколегированных сталей, когда к металлу сварных швов предъявляют повышенные требования по пластичности и ударной вязкости, особенно при работе в условиях пониженных температур. Сварка во всех пространственных положениях, кроме вертикального сверху вниз, постоянным током обратной полярности.

Рекомендуемое значение тока (А)

Диаметр, мм Положение шва
нижнее вертикальное потолочное
2,0 40-60 40-60 40-60
2,5 55-80 50-65 45-65
3,0 90-120 80-100 70-90
4,0 130-150 130-140 110-130
5,0 180-210 160-180
6,0 210-240

Характеристики плавления электродов

— Коэффициент наплавки, г/Ач: 9,0

— Расход электродов на 1кг наплавленного металла, кг: 1,7

Основные характеристики металла шва и наплавленного металла

Механические свойства металла шва, не менее

— Временное сопротивление разрыву, МПа: 510

— Предел текучести, МПа: 410

— Относительное удлинение, %: 20

— Ударная вязкость, Дж/см², при температуре +20°С: 130

— Ударная вязкость, Дж/см², при температуре -40°С: 100

— Ударная вязкость, Дж/см², при температуре -60°С: 80

Химический состав наплавленного металла, %

— Углерод, не более: 0,12

— Марганец: 0,70-1,20

— Кремний: 0,20-0,50

— Сера, не более: 0,030

— Фосфор, не более: 0,030

ГОСТ 9466-75
ГОСТ 9467-75
ТУ 1272-003-01055859-2003

AWS:E7016-1
DIN1913:E5143В10
EN499:Е383В12

Э50А-ЛЭЗ УОНИ-13/55-Ø-УД / Е 515-Б26

Сварочные электроды VISTEC УОНИ 13/55 5 мм 5 кг

Сварочные электроды УОНИ 13/55 VISTECTM — это:

  • ЛЕГКОЕ НАЧАЛЬНОЕ И ПОВТОРНОЕ ЗАЖИГАНИЕ
  • СТАБИЛЬНОЕ ГОРЕНИЕ ДУГИ
  • УМЕРЕННЫЕ ПОТЕРИ МЕТАЛЛА ОТ РАЗБРЫЗГИВАНИЯ
  • ПОЛУЧЕНИЕ КАЧЕСТВЕННОГО СВАРОЧНОГО ШВА
  • ВЫСОКАЯ СТОЙКОСТЬ НАПЛАВЛЕННОГО МЕТАЛЛА К ОБРАЗОВАНИЮ КРИСТАЛЛИЗАЦИОННЫХ ТРЕЩИН
  • УДОВЛЕТВОРИТЕЛЬНАЯ ОТДЕЛИМОСТЬ ШЛАКОВОЙ КОРКИ

Вид покрытия: основное

Условное обозначение и классификация:

Э50А-УОНИ 13/55-d-УД

Е514-Б20

ГОСТ 9466-75

ТУ У 05416923.015-96

 ГОСТ 9467-75  Э50А
 AWS A 5.1  E 7015
 DIN 1913  E 51 43 B 20
 ISO 2560  E 51 4 B 20
 EN 499  E 38 3 B 22

Назначение и область применения:

для ручной дуговой сварки на постоянном токе обратной полярности ответственных конструкций из углеродистых (типа 08, 20, 20Л, Ст.3, Ст.4) и низколегированных (типа 16ГС, 09Г2С) марок сталей, когда к металлу сварных швов предъявляются повышенные требования по пластичности и ударной вязкости;

рекомендуются для сварки конструкций, работающих в условиях пониженных температур и знакопеременных нагрузок;

сварку производят только на короткой длине дуги методом опирания по тщательно очищенным кромкам. 

Особенности маркировки электродов VISTECTM УОНИ 13/55:

  • на контактный торец электрода нанесено ионизирующее покрытие, способствующее легкому первоначальному розжигу;
  • на покрытие электрода нанесена маркировка «VT УОНИ 13/55».

 

Производитель: ЧАО «ВИСТЕК»

Электроды УОНИ-13/55 — WikiWeld — Библиотека Сварщика

Группа электродов

Для сварки углеродистых и низколегированных конструкционных сталей

Условное обозначение электродов

Э50А-УОНИИ-13/55-Ø-УД
Е 51 4 -Б20

Назначение электродов УОНИИ-13/55

ПараметрЗначение
ИзделиеОсобо ответственные конструкции, когда к металлу шва предъявляют повышенные требования по пластичности и ударной вязкости, в том числе и в условиях знакопеременных нагрузок и пониженных температур
МатериалУглеродистые и низколегированные стали
Пространственное положениеЛюбое
ТокПостоянный обратной полярности

Характеристика электродов УОНИИ-13/55

ПараметрЗначение
ПокрытиеОсновное
ТипЭ50А
Коэффициент наплавки9,5 г/А·ч
Производительность наплавки (для диаметра 4,0 мм)1,4 кг/ч
Расход электродов на 1 кг наплавленного металла1,7 кг

Геометрические размеры и сила тока при сварке

Диаметр (мм)Длина (мм)Ток (А)Среднее количество электродов в 1кг (шт)
2,030040-9098
2,535050-10055
3,035060-13040
4,0450100-18015
5,0450140-21011

Типичные механические свойства металла шва

ПараметрЗначение
Временное сопротивление (МПа)540
Предел текучести (МПа)410
Относительное удлинение (%)29
Ударная вязкость (Дж/см2)260

Типичный химический состав наплавленного металла (%)

CMnSiSP
0,091,050,420,0220,024

Особые свойства электродов УОНИИ-13/55

  1. Обеспечивают получение металла шва с особой металлургической чистотой и низким содержанием водорода
  2. Очень малая склонность к образованию горячих кристаллизационных трещин
  3. Обеспечивают сварку стабильной, спокойной дугой – хорошо подходит для сварки в сложных условиях.
  4. Характеризуются высокой стойкостью металла шва против образования кристаллизационных трещин и низким содержанием водорода в наплавленном металле

Технологические особенности сварки электродами УОНИИ-13/55

  1. Сварку производят только на короткой длине дуги по очищенным кромкам
  2. Прокалка перед сваркой: 330-350 °С в течение 1 часа

Редакция сайта wikiweld.ru «Библиотека сварщика». Обзоры на сварочное оборудование, рейтинги и полезные статьи. Экспертные мнения и лайфхаки. Связь с нами: [email protected]

Понравилась статья? Поделиться с друзьями:

УОНИ 13-55

УОНИ 13-55

Часть доходов от продаж перечисляется в фонд «Родители Урала за мир без преступности, насилия, наркотиков». Покупая товар на нашем сайте, Вы помогаете сделать будущее наших с вами детей безопаснее!

Заказать

Электроды применяются для сварки особо ответственных конструкций из углеродистых и низколегированных сталей, когда к металлу швов предъявляют повышенные требования по пластичности и ударной вязкости. Сварка во всех пространственных положениях шва постоянным током обратной полярности. Они обеспечивают получение металла шва с высокой стойкостью к образованию кристаллизационных трещин и низким содержанием водорода.

ХАРАКТЕРИСТИКА ЭЛЕКТРОДОВ

Покрытие – основное.
Коэффициент наплавки – 9,5 г/А* ч.
Производительность наплавки для диаметра 4.0 мм — 1,4 кг/ч.
Расход электродов на 1 кг наплавленного металла – 1,7 кг.

ТИПИЧНЫЕ МЕХАНИЧЕСКИЕ СВОЙСТВА МЕТАЛЛА ШВА

Временное сопротивление,sв, МПаПредел текучести, sт, МПаОтносительное удлинение, d5 , %Ударная вязкость, KCU, Дж/см2
54041026230

ТИПИЧНЫЙ ХИМИЧЕСКИЙ СОСТАВ НАПЛАВЛЕННОГО МЕТАЛЛА, %

СMnSiSР
0,090,830,420,0220,024

ТЕХНИЧЕСКИЕ ПАРАМЕТРЫ

Диаметр, ммДлина, ммТок, АСреднее количество электродов в 1 кг, шт
3,035060-13040
4,0450100-18015
5,0450140-26011

Сварку производят короткой дугой по очищенным кромкам. Электроды перед сваркой прокалить при температуре 300-350 оС в течение одного часа.

На нашем сайте мы используем cookie для сбора информации технического характера.

ОК

X

Уже уходите?

Помогите нам стать еще лучше. Выберите, пожалуйста, причину своего ухода:

клинических характеристик 138 госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом 2019 года, в Ухане, Китай | Медицина интенсивной терапии | ДЖАМА

Ключевые моменты

Вопрос Каковы клинические характеристики госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом (2019-nCoV) 2019 года (NCIP), в Ухане, Китай?

Выводы В этой одноцентровой серии случаев с участием 138 пациентов с NCIP 26% пациентов нуждались в госпитализации в отделение интенсивной терапии и 4.3% умерли. Предполагаемая внутрибольничная передача 2019-nCoV от человека к человеку была заподозрена у 41% пациентов.

Значение В этой серии случаев в Ухане, Китай, NCIP часто ассоциировался с предполагаемой внутрибольничной передачей, 26% пациентов нуждались в лечении в отделении интенсивной терапии, а смертность составила 4,3%.

Важность В декабре 2019 года в Ухане, Китай, произошла пневмония, инфицированная новым коронавирусом (2019-nCoV).Число случаев быстро увеличилось, но информация о клинических характеристиках пораженных пациентов ограничена.

Цель Описать эпидемиологические и клинические характеристики NCIP.

Дизайн, сеттинг и участники Ретроспективная одноцентровая серия случаев из 138 последовательно госпитализированных пациентов с подтвержденным NCIP в больнице Чжуннань Уханьского университета в Ухане, Китай, с 1 по 28 января 2020 г.; окончательная дата наблюдения — 3 февраля 2020 г.

Воздействие Документированный НКИП.

Основные результаты и показатели Были собраны и проанализированы эпидемиологические, демографические, клинические, лабораторные, рентгенологические данные и данные о лечении. Исходы пациентов в критическом состоянии и пациентов в некритическом состоянии сравнивались. Предполагаемая внутрибольничная передача подозревалась, если заражалась группа медицинских работников или госпитализированных пациентов в одних и тех же отделениях и можно было отследить возможный источник инфекции.

Результаты Среди 138 госпитализированных пациентов с NCIP средний возраст составил 56 лет (межквартильный диапазон 42-68 лет, диапазон 22-92 года), 75 (54,3%) были мужчинами. Внутрибольничная передача подозревалась как предполагаемый механизм заражения пострадавших медицинских работников (40 [29%]) и госпитализированных пациентов (17 [12,3%]). Общие симптомы включали лихорадку (136 [98,6%]), утомляемость (96 [69,6%]) и сухой кашель (82 [59,4%]). Лимфопения (количество лимфоцитов, 0,8 × 10 9 /л [межквартильный размах {IQR}, 0.6-1.1]) наблюдалось у 97 пациентов (70,3%), увеличение протромбинового времени (13,0 секунд [МКИ, 12,3-13,7]) у 80 пациентов (58%) и повышение уровня лактатдегидрогеназы (261 Ед/л [МКИ, 182-182%]). 403]) у 55 больных (39,9%). Компьютерная томография грудной клетки показала двусторонние пятнистые тени или непрозрачность по типу «матового стекла» в легких у всех пациентов. Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%]; цефтриаксон, 34 [24,6%]; азитромицин, 25 [18.4%].1%]) и глюкокортикоидной терапии (62 [44,9%]). Тридцать шесть пациентов (26,1%) были переведены в отделение реанимации и интенсивной терапии (ОИТ) из-за осложнений, в том числе острого респираторного дистресс-синдрома (22 [61,1%]), аритмии (16 [44,4%]) и шока (11 [30,6%]). %]). Среднее время от первого симптома до появления одышки составило 5,0 дней, до госпитализации — 7,0 дней, до ОРДС — 8,0 дней. Пациенты, получавшие лечение в отделении интенсивной терапии (n = 36), по сравнению с пациентами, не получавшими лечения в отделении интенсивной терапии (n = 102), были старше (медиана возраста 66 лет против 51 года), чаще имели сопутствующие заболевания (26 [72.2%] по сравнению с 38 [37,3%]), и чаще страдали одышкой (23 [63,9%] по сравнению с 20 [19,6%]) и анорексией (24 [66,7%] по сравнению с 31 [30,4%]). Из 36 больных в ОИТ 4 (11,1%) получали высокопотоковую оксигенотерапию, 15 (41,7%) — неинвазивную вентиляцию легких, 17 (47,2%) — инвазивную вентиляцию легких (4 переведены на экстракорпоральную мембранную оксигенацию). По состоянию на 3 февраля выписано 47 пациентов (34,1%), умерло 6 (общая летальность 4,3%), но остальные пациенты остаются на стационарном лечении. Среди выписанных живыми (n = 47) медиана пребывания в стационаре составила 10 дней (IQR, 7.0-14,0).

Выводы и актуальность В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая внутрибольничная передача 2019-nCoV подозревалась у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%.

Quiz Ref IDВ декабре 2019 года в Ухане, провинция Хубэй, Китай, произошел кластер острых респираторных заболеваний, теперь известных как пневмония, инфицированная новым коронавирусом (NCIP). 1 -5 Болезнь быстро распространилась из Ухани в другие районы. По состоянию на 31 января 2020 г. в Китае было подтверждено в общей сложности 9692 случая NCIP. На международном уровне случаи были зарегистрированы в 24 странах и на 5 континентах. 6 3 января 2020 г. новый коронавирус 2019 г. (2019-nCoV) был обнаружен в образцах жидкости бронхоальвеолярного лаважа у пациента в Ухане и подтвержден как причина NCIP. 7 Полное секвенирование генома и филогенетический анализ показали, что 2019-nCoV является кладой, отличной от бета-коронавирусов, связанных с тяжелым острым респираторным синдромом (ТОРС) и ближневосточным респираторным синдромом (БВРС) человека. 7 2019-nCoV имеет черты, типичные для семейства коронавирусов, и относится к линии бета-коронавируса 2b. 2019-nCoV очень похож на коронавирусы летучих мышей, и было высказано предположение, что летучие мыши являются основным источником. Хотя происхождение 2019-nCoV все еще исследуется, имеющиеся данные свидетельствуют о том, что распространение среди людей произошло в результате передачи от диких животных, незаконно проданных на оптовом рынке морепродуктов Хуанань. 8

Huang et al 9 впервые сообщили о 41 случае NCIP, в которых большинство пациентов в анамнезе контактировали с оптовым рынком морепродуктов Huanan.Клинические проявления пациентов включали лихорадку, непродуктивный кашель, одышку, миалгию, утомляемость, нормальный или сниженный уровень лейкоцитов и рентгенологические признаки пневмонии. Органная дисфункция (например, шок, острый респираторный дистресс-синдром [ОРДС], острая сердечная недостаточность и острая почечная недостаточность) и смерть могут наступить в тяжелых случаях. 9 Впоследствии Chen et al 8 сообщили о результатах 99 случаев NCIP в той же больнице, и результаты показали, что инфекция 2019-nCoV, сгруппированная в группах людей, находящихся в тесном контакте, с большей вероятностью поражала пожилых мужчин с сопутствующими заболеваниями. и может привести к ОРДС.Однако о разнице в клинических характеристиках между тяжелыми и нетяжелыми случаями не сообщалось. Сообщения о случаях заболевания подтвердили передачу NCIP от человека к человеку. 10 ,11 В настоящее время не существует эффективных методов лечения или вакцин против NCIP. Цель этой серии случаев состояла в том, чтобы описать клинические характеристики 138 госпитализированных пациентов с NCIP и сравнить тяжелые случаи, которые получали лечение в отделении интенсивной терапии (ОИТ), с нетяжелыми случаями, которые не получали помощь в ОИТ.

Дизайн исследования и участники

Quiz Ref IDЭта серия случаев была одобрена институциональным советом по этике больницы Чжуннань Уханьского университета (№ 2020020). В исследование были включены все последовательные пациенты с подтвержденным NCIP, поступившие в больницу Чжуннань Уханьского университета с 1 по 28 января 2020 года.От пациентов было получено устное согласие. Больница Чжуннань, расположенная в Ухане, провинция Хубэй, эндемичных районах NCIP, является одной из крупнейших третичных учебных больниц и отвечает за лечение NCIP, назначенное правительством. Все пациенты с NCIP, включенные в это исследование, были диагностированы в соответствии с временным руководством Всемирной организации здравоохранения. 12 Клинические исходы (например, выписка, смертность, продолжительность пребывания в стационаре) отслеживались до 3 февраля 2020 г., последней даты наблюдения.

Медицинские карты пациентов были проанализированы исследовательской группой отделения интенсивной терапии больницы Чжуннань Уханьского университета. Эпидемиологические, клинико-лабораторные и радиологические характеристики, а также данные о лечении и исходах были получены с помощью форм сбора данных из электронных медицинских карт. Данные были проверены обученной командой врачей. Записанная информация включала демографические данные, историю болезни, историю воздействия, основные сопутствующие заболевания, симптомы, признаки, лабораторные данные, компьютерную томографию (КТ) грудной клетки и меры лечения (например, противовирусную терапию, терапию кортикостероидами, респираторную поддержку, заместительную почечную терапию).Датой начала заболевания считали день, когда был замечен симптом. Были собраны симптомы, признаки, лабораторные показатели, КТ грудной клетки и меры лечения во время пребывания в больнице. ОРДС был определен в соответствии с берлинским определением. 13 Острое повреждение почек было выявлено в соответствии с определением болезни почек: улучшение глобальных результатов. 14 Сердечная травма определялась, если сывороточные уровни сердечных биомаркеров (например, тропонина I) превышали верхний референтный предел 99-го процентиля или при электрокардиографии и эхокардиографии обнаруживались новые отклонения. 9 Для пациентов, поступивших в отделение интенсивной терапии, в день поступления в отделение интенсивной терапии определялись баллы по шкале комы Глазго, оценке последовательной органной недостаточности и оценке острой физиологии и хронического состояния здоровья II. Регистрировали продолжительность от начала заболевания до госпитализации, одышки, ОРДС и госпитализации в ОИТ.

Подозрение на внутрибольничную передачу возникало, если группа медицинских работников или госпитализированных пациентов в одних и тех же отделениях заражалась в течение определенного периода времени и можно было отследить возможный источник инфекции.

Анализ полимеразной цепной реакции с обратной транскрипцией в реальном времени для nCoV

Было собрано

образца мазка из горла для выделения РНК 2019-nCoV у пациентов с подозрением на инфекцию 2019-nCoV. После сбора мазки из зева помещали в пробирку для сбора со 150 мкл раствора для сохранения вируса, и тотальную РНК экстрагировали в течение 2 часов с использованием набора для выделения РНК из респираторных образцов (Чжунчжи, Ухань, Китай).Вкратце, 40 мкл клеточных лизатов переносили в пробирку для сбора с последующим встряхиванием в течение 10 секунд. После стояния при комнатной температуре в течение 10 минут пробирку для сбора центрифугировали при 1000 об/мин в течение 5 минут. Суспензию использовали для анализа полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) в реальном времени РНК 2019-nCoV. Два гена-мишени, включая открытую рамку считывания 1ab ( ORF1ab ) и нуклеокапсидный белок (N), одновременно амплифицировали и тестировали в ходе анализа ОТ-ПЦР в реальном времени.Мишень 1 ( ORF1ab ): прямой праймер CCCTGTGGGTTTTACACTTAA; обратный праймер ACGATTGTGCATCAGCTGA; и зонд 5′-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′. Мишень 2 (N): прямой праймер GGGGAACTTCTCCTGCTAGAAT; обратный праймер CAGACATTTTGCTCTCAAGCTG; и зонд 5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′. Анализ ОТ-ПЦР в реальном времени проводили с использованием набора для обнаружения нуклеиновых кислот 2019-nCoV в соответствии с протоколом производителя (Shanghai bio-germ Medical Technology Co Ltd). Реакционная смесь содержит 12 мкл реакционного буфера, 4 мкл раствора фермента, 4 мкл раствора праймеров Probe, 3 мкл воды, обработанной диэтилпирокарбонатом, и 2 мкл матрицы РНК.Анализ ОТ-ПЦР проводили в следующих условиях: инкубация при 50 °С в течение 15 минут и при 95 °С в течение 5 минут, 40 циклов денатурации при 94 °С в течение 15 секунд, удлинение и сбор сигнала флуоресценции при 55 °С в течение 45 секунд. Пороговое значение цикла (значение Ct) менее 37 определялось как положительный результат теста, а значение Ct 40 или более определялось как отрицательный результат теста. Эти диагностические критерии были основаны на рекомендации Национального института по контролю и профилактике вирусных заболеваний (Китай) (http://ivdc.chinacdc.cn/kyjz/202001/t20200121_211337.html). Средняя нагрузка, определяемая как значение Ct от 37 до менее 40, требовала подтверждения повторным тестированием.

Категориальные переменные были описаны как частоты и проценты, а непрерывные переменные были описаны с использованием значений среднего, медианы и межквартильного диапазона (IQR). Средние значения для непрерывных переменных сравнивались с использованием независимых групповых тестов t , когда данные были нормально распределены; в противном случае использовался критерий Манна-Уитни.Данные (ненормальное распределение) повторных измерений сравнивались с использованием обобщенной линейной смешанной модели. Доли категориальных переменных сравнивались с использованием критерия χ 2 , хотя при ограниченности данных использовался точный критерий Фишера. Все статистические анализы проводились с использованием программного обеспечения SPSS (Statistical Package for the Social Sciences) версии 13.0 (SPSS Inc). Для нескорректированных сравнений двустороннее значение α менее 0,05 считалось статистически значимым. Анализы не были скорректированы для множественных сравнений, и, учитывая возможность ошибки I рода, результаты следует интерпретировать как исследовательские и описательные.

Представление характеристик

Исследуемая популяция включала 138 госпитализированных пациентов с подтвержденным NCIP. Медиана возраста составила 56 лет (МКР 42-68 лет, диапазон 22-92 года), 75 (54,3%) мужчин. Из них 102 (73,9%) больных были госпитализированы в изолятор, а 36 (26.1%) были госпитализированы и переведены в ОРИТ в связи с развитием органной дисфункции (табл. 1). Средняя продолжительность от первых симптомов до одышки, госпитализации и ОРДС составила 5 дней (IQR, 1–10), 7 дней (IQR, 4–8) и 8 дней (IQR, 6–12) соответственно (таблица 1). ). Из 138 пациентов 64 (46,4%) имели 1 или более сопутствующих заболеваний. Гипертония (43 [31,2%]), диабет (14 [10,1%]), сердечно-сосудистые заболевания (20 [14,5%]) и злокачественные новообразования (10 [7,2%]) были наиболее распространенными сопутствующими состояниями.

Наиболее частыми симптомами в начале болезни были лихорадка (136 [98,6%]), утомляемость (96 [69,6%]), сухой кашель (82 [59,4%]), миалгия (48 [34,8%]) и одышка ( 43 [31,2%]). Менее распространенными симптомами были головная боль, головокружение, боль в животе, диарея, тошнота и рвота (таблица 1). В общей сложности у 14 пациентов (10,1 %) первоначально развились диарея и тошнота за 1–2 дня до развития лихорадки и одышки.

По сравнению с пациентами, которые не получали помощь в отделении интенсивной терапии (n = 102), пациенты, нуждавшиеся в помощи в отделении интенсивной терапии (n = 36), были значительно старше (медиана возраста 66 лет [IQR, 57-78] по сравнению с 51 годом [IQR, 37-78]. 62]; P  < .001) и чаще имели сопутствующие заболевания, включая гипертонию (21 [58,3%] против 22 [21,6%], диабет (8 [22,2%] против 6 [5,9%]), сердечно-сосудистые заболевания (9 [25,0%] против 11 [10,8%]) и цереброваскулярные заболевания (6 [16,7%] против 1 [1,0%]). боль и анорексия

Показатели жизнедеятельности и лабораторные параметры в ОИТ и у пациентов, не находящихся в ОИТ

Частота сердечных сокращений, частота дыхания и среднее артериальное давление не отличались между пациентами, получавшими помощь в отделении интенсивной терапии, и пациентами, которые не получали помощь в отделении интенсивной терапии.Эти показатели регистрировались в день поступления в стационар для всех пациентов, затем разделялись на тех, кто впоследствии был госпитализирован в ОИТ или нет. Были многочисленные различия в лабораторных данных между пациентами, поступившими в отделение интенсивной терапии, и пациентами, не госпитализированными в отделение интенсивной терапии (таблица 2), включая более высокое количество лейкоцитов и нейтрофилов, а также более высокие уровни D-димера, креатинкиназы и креатина. Все 138 зарегистрированных пациентов показали двустороннее поражение при КТ грудной клетки (рис. 1). Среднее время от появления симптомов до госпитализации в ОИТ составило 10 дней (межквартильный интервал 6–12) (таблица 3).Медиана шкалы комы Глазго в день поступления в отделение интенсивной терапии; Острая физиология и оценка хронического состояния здоровья II; и оценка последовательной органной недостаточности составила 15 (IQR, 9–15), 17 (IQR, 10–22) и 5 ​​(IQR, 3–6) соответственно (таблица 3). Среднее значение парциального давления кислорода составило 68 мм рт. ст. (IQR, 56–89), а медиана отношения парциального давления кислорода к фракции вдыхаемого кислорода составила 136 мм рт. ст. (IQR, 103–234).

Органные дисфункции и основные вмешательства

Органная дисфункция и лечение 138 пациентов показаны в Таблице 4.По состоянию на 3 февраля 2020 г. в стационаре остаются 85 пациентов (61,6%). Всего выписано 47 пациентов (34,1%), умерло 6 пациентов (4,3%). Из 36 пациентов, поступивших в отделение интенсивной терапии, 11 все еще находились в отделении интенсивной терапии, 9 были выписаны домой, 10 переведены в общие палаты, 6 умерли. Из 11 пациентов, оставшихся в ОРИТ, 6 получили инвазивную вентиляцию легких (1 перешел на экстракорпоральную мембранную оксигенацию) и 5 ​​на неинвазивную вентиляцию легких). Общие осложнения среди 138 пациентов включали шок (12 [8.7%]), ОРДС (27 [19,6%]), аритмия (23 [16,7%]) и острое повреждение сердца (10 [7,2%]). Пациенты, получавшие помощь в ОИТ, чаще имели одно из этих осложнений, чем пациенты, не получавшие ОИТ.

Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%]; цефтриаксон, 34 [24,6%]; азитромицин, 25 [18,1%]) и терапию глюкокортикоидами ( 62 [44,9%]). В отделении интенсивной терапии 4 пациента (11,1%) получали высокопоточный кислород и 15 (44.4%) получали неинвазивную вентиляцию легких. Инвазивная искусственная вентиляция легких потребовалась 17 пациентам (47,2%), 4 из которых в качестве экстренной терапии получили экстракорпоральную мембранную оксигенацию. Вазопрессоры получали 13 пациентов, заместительную почечную терапию получали 2 пациента.

Динамический профиль лабораторных показателей у пациентов с NCIP

Для определения основных клинических особенностей, возникающих при прогрессировании НКИП, отслеживали динамическую динамику 6 клинико-лабораторных показателей, включая гематологические и биохимические показатели, с 1-го по 19-й день от начала заболевания с интервалом в 2 дня.На конец 28 января 2020 г. были проанализированы данные 33 пациентов с полным клиническим течением (рис. 2). Во время госпитализации у большинства пациентов отмечалась выраженная лимфопения, а у невыживших со временем развилась более тяжелая лимфопения. Количество лейкоцитов и количество нейтрофилов было выше у невыживших, чем у выживших. Уровень D-димера был выше у невыживших, чем у выживших. Точно так же по мере прогрессирования заболевания и ухудшения клинического состояния уровни мочевины и креатинина в крови прогрессивно повышались перед смертью.

Предполагаемая внутрибольничная передача и инфекция

Из 138 пациентов 57 (41,3%) предположительно заразились в стационаре, в том числе 17 пациентов (12,3%), которые уже были госпитализированы по другим причинам, и 40 медицинских работников (29%). Из госпитализированных пациентов 7 пациентов были из хирургического отделения, 5 из внутренних болезней и 5 из онкологического отделения.Из инфицированных медицинских работников 31 (77,5%) работали в общих палатах, 7 (17,5%) в отделении неотложной помощи и 2 (5%) в отделении интенсивной терапии. Один пациент в текущем исследовании имел абдоминальные симптомы и был госпитализирован в хирургическое отделение. Предполагалось, что более 10 медицинских работников этого отделения заразились от этого пациента. Также предполагалось, что имела место передача от пациента к пациенту, и по крайней мере 4 госпитализированных пациента в одном отделении были инфицированы, и у всех были атипичные абдоминальные симптомы.У одного из 4 пациентов была лихорадка, и во время госпитализации у него была диагностирована инфекция nCoV. Затем больной был изолирован. Впоследствии у других 3 пациентов в том же отделении была лихорадка, абдоминальные симптомы, и у них была диагностирована инфекция nCoV.

Quiz Ref IDЭтот отчет, насколько нам известно, представляет собой крупнейшую на сегодняшний день серию случаев госпитализации пациентов с NCIP. По состоянию на 3 февраля 2020 года из 138 пациентов, включенных в это исследование, 26% нуждались в отделении интенсивной терапии, 34.1% выписаны, 6 умерли (4,3%), 61,6% остаются в больнице. Для тех, кто был выписан (n = 47), пребывание в стационаре составило 10 дней (IQR, 7,0-14,0). Время от начала до одышки составило 5,0 дней, 7,0 дней до госпитализации и 8,0 дней до ОРДС. Общими симптомами в начале болезни были лихорадка, сухой кашель, миалгия, утомляемость, одышка и анорексия. Однако у значительной части пациентов изначально были атипичные симптомы, такие как диарея и тошнота. Основные осложнения во время госпитализации включали ОРДС, аритмию и шок.Двустороннее распределение пятнистых теней и непрозрачности матового стекла было типичным признаком КТ для NCIP. Большинство пациентов в критическом состоянии были старше и имели больше сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Большинству пациентов требовалась оксигенотерапия, и меньшинство пациентов нуждалось в инвазивной вентиляции или даже в экстракорпоральной мембранной оксигенации.

Quiz Ref IDДанные этого исследования позволяют предположить, что могла иметь место быстрая передача 2019-nCoV от человека к человеку. Основная причина вытекает из оценки основного репродуктивного числа (R 0 ) на основе предыдущего исследования. 15 R 0 указывает, насколько заразно инфекционное заболевание. Когда инфекция распространяется на новых людей, она воспроизводит себя; R 0 указывает среднее число дополнительных лиц, которых один больной заражает в течение болезни, и конкретно относится к популяции людей, которые ранее не были инфицированы и не были вакцинированы. Согласно отчету, R 0 от nCoV составляет 2,2, что означает, что в среднем каждый пациент распространял инфекцию на 2.2 других человека. 15 Одна из причин быстрого распространения может быть связана с атипичными симптомами на ранней стадии у некоторых пациентов, инфицированных nCoV.

Недавнее исследование показало, что nCoV был обнаружен в образцах стула пациентов с абдоминальными симптомами. 16 Однако сложно дифференцировать и проводить скрининг пациентов с атипичными симптомами. Тем не менее, быстрая передача инфекции от человека к человеку при тесных контактах является важной особенностью пневмонии, вызванной nCoV. 10 ,11,15

Пациенты, поступившие в отделение интенсивной терапии, были старше и имели большее количество сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Это говорит о том, что возраст и сопутствующие заболевания могут быть факторами риска неблагоприятного исхода. Однако не было никакой разницы в доле мужчин и женщин между пациентами ОИТ и пациентами, не находящимися в ОИТ. Эти данные отличаются от недавнего отчета, который показал, что инфекция 2019-nCoV чаще поражает мужчин. 8 Возможное объяснение заключается в том, что инфекция nCoV у пациентов в предыдущем отчете была связана с воздействием, связанным с оптовым рынком морепродуктов Хуанань, и большинство пострадавших пациентов были работниками мужского пола.По сравнению с симптомами у пациентов, не находившихся в отделении интенсивной терапии, симптомы чаще встречались у пациентов в критическом состоянии, включая одышку, боль в животе и анорексию. Появление симптомов может помочь врачам выявить пациентов с плохим прогнозом. В этой когорте общие показатели тяжелой гипоксии и инвазивной вентиляции были выше, чем в предыдущем исследовании, 9 , вероятно, потому, что случаи в предыдущем исследовании относились к ранней эпидемической стадии NCIP, а текущие случаи относятся к стадия вспышки.

Наиболее распространенными лабораторными отклонениями, наблюдаемыми в этом исследовании, были снижение общего числа лимфоцитов, удлинение протромбинового времени и повышение уровня лактатдегидрогеназы. По сравнению с пациентами, не находившимися в отделении интенсивной терапии, у пациентов, получавших помощь в отделении интенсивной терапии, были многочисленные лабораторные отклонения. Эти аномалии предполагают, что инфекция 2019-nCoV может быть связана с дефицитом клеточного иммунитета, активацией коагуляции, повреждением миокарда, поражением печени и почек. Эти лабораторные отклонения аналогичны тем, которые ранее наблюдались у пациентов с инфекцией MERS-CoV и SARS-CoV.

Динамический профиль лабораторных данных прослежен у 33 пациентов с NCIP (5 невыживших и 28 выживших). У невыживших продолжали увеличиваться количество нейтрофилов, D-димера, мочевины и креатинина в крови, а количество лимфоцитов продолжало снижаться до тех пор, пока не наступала смерть. Нейтрофилия может быть связана с цитокиновым штормом, вызванным инвазией вируса, активация коагуляции могла быть связана с устойчивым воспалительным ответом, а острое повреждение почек могло быть связано с прямым воздействием вируса, гипоксией и шоком.Три патологических механизма могут быть связаны со смертью пациентов с NCIP.

Quiz Ref IДо сих пор не было рекомендовано никакого специального лечения коронавирусной инфекции, кроме тщательной поддерживающей терапии. 17 В настоящее время подход к этому заболеванию заключается в контроле источника инфекции; использование средств индивидуальной защиты для снижения риска передачи инфекции; и ранняя диагностика, изоляция и поддерживающее лечение пострадавших пациентов. Антибактериальные средства малоэффективны.Кроме того, не было обнаружено никаких противовирусных средств, полезных для лечения SARS и MERS. Все пациенты в этом исследовании получали антибактериальные препараты, 90% получали противовирусную терапию и 45% получали метилпреднизолон. Доза осельтамивира и метилпреднизолона варьировала в зависимости от тяжести заболевания. Однако эффективных результатов не наблюдалось.

Это исследование имеет несколько ограничений. Во-первых, образцы из дыхательных путей использовались для диагностики NCIP с помощью RT-PCR.Сыворотки больных для оценки виремии не получали. Вирусная нагрузка является потенциально полезным маркером, связанным с тяжестью заболевания коронавирусной инфекцией, и ее следует определять в NCIP. Во-вторых, внутрибольничная передача/инфекция не могла быть окончательно доказана, но подозревалась и предполагалась на основании времени и моделей контакта с инфицированными пациентами и последующего развития инфекции. В-третьих, среди 138 случаев большинство пациентов все еще находятся в больнице на момент подачи рукописи.Поэтому трудно оценить факторы риска неблагоприятного исхода, и необходимы постоянные наблюдения за естественным течением заболевания.

В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая внутрибольничная передача 2019-nCoV была заподозрена у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%. .

Авторы, переписывающиеся: Чжиюн Пэн, доктор медицинских наук, отделение интенсивной терапии ([email protected]) и Xinghuan Wang, MD, Отделение урологии ([email protected]), Больница Чжуннань Уханьского университета, Ухань 430071, Хубэй, Китай.

Принято к публикации: 3 февраля 2020 г.

Опубликовано в Интернете: 7 февраля 2020 г. правильные данные для пациентов женского пола в таблице 1.

Вклад авторов: Drs D.Ван и Пэн имели полный доступ ко всем данным исследования и брали на себя ответственность за целостность данных и точность анализа данных. Доктора Д. Ван и Б. Ху внесли равный вклад и разделили первое авторство. В подготовке этой статьи в равной степени участвовали доктора Пэн и X. Ван.

Концепция и дизайн: D. Wang, B. Hu, C. Hu, Xiong, Zhao, Li, X. Wang, Peng.

Сбор, анализ или интерпретация данных: D. Wang, C. Hu, Zhu, Liu, Zhang, B. Wang, Xiang, Cheng, Xiong, Peng.

Составление рукописи: D. Wang, C. Hu, Xiang, Xiong, Li, Peng.

Критическая проверка рукописи на наличие важного интеллектуального содержания: D. Wang, B. Hu, Zhu, Liu, Zhang, B. Wang, Cheng, Xiong, Zhao, X. Wang, Peng.

Статистический анализ: К. Ху, Чжу, Лю, Б. Ван, Сюн.

Получено финансирование: Д. Ван, Пэн.

Административная, техническая или материальная поддержка: B. Hu, Xiang, Cheng, Xiong, Li, X.Ван.

Надзор: Б. Ху, Сюн, Чжао, С. Ван, Пэн.

Конфликт интересов Раскрытие информации: Не сообщалось.

Финансирование/поддержка: Эта работа была поддержана Национальным фондом естественных наук (грант 81701941 д-ру Д. Вану; гранты 81772046 и 81971816 д-ру Пэну) и Специальным проектом по значительным исследованиям и разработкам новых лекарств в крупных национальных Научно-технические проекты Китая (2020ZX09201007, доктору Пэну).

Роль спонсора/спонсора: Спонсоры не участвовали в разработке и проведении исследования; сбор, управление, анализ и интерпретация данных; подготовка, рецензирование или утверждение рукописи; и решение представить рукопись для публикации.

1.Лу Х, Стрэттон CW, Танг Ю.В. Вспышка пневмонии неизвестной этиологии в Ухане, Китай: тайна и чудо [опубликовано 16 января 2020 г.]. J Med Virol . 2020. doi:10.1002/jmv.25678PubMedGoogle Scholar2.Hui ДС, я Ажар Э, Мадани ТА, и другие. Продолжающаяся эпидемическая угроза новых коронавирусов 2019-nCoV для глобального здравоохранения: последняя вспышка нового коронавируса 2019 года в Ухане, Китай [опубликовано 14 января 2020 г.].  Int J Infect Dis . 2020;91:264-266. doi:10.1016/j.ijid.2020.01.009PubMedGoogle ScholarCrossref 7.Zhu Н, Чжан Д, Ван Вт, и другие; Китайская группа по расследованию и исследованию нового коронавируса.Новый коронавирус от пациентов с пневмонией в Китае, 2019 г. [опубликовано 24 января 2020 г.]. N Engl J Med . doi:10.1056/NEJMoa2001017PubMedGoogle Scholar8.Chen Н, Чжоу М, Донг ИКС, и другие. Эпидемиологические и клинические характеристики 99 случаев новой коронавирусной пневмонии 2019 г. в Ухане, Китай: описательное исследование [опубликовано 29 января 2020 г.].  Ланцет . doi:10.1016/S0140-6736(20)30211-7PubMedGoogle Scholar10.Chan JF-W, Юань С, Кок К-Х, и другие.Семейный кластер пневмонии, связанный с новым коронавирусом 2019 года, указывающий на передачу от человека к человеку: исследование семейного кластера [опубликовано 24 января 2020 г.].  Ланцет . 2020;S0140-6736(20)30154-9. doi:10.1016/S0140-6736(20)30154-9PubMedGoogle Scholar11.Phan LT, Нгуен ТВ, Луонг КК, и другие. Импорт и передача нового коронавируса от человека человеку во Вьетнаме [опубликовано 28 января 2020 г.]. N Engl J Med . дои: 10.1056/NEJMc2001272PubMedGoogle Scholar13.Ranieri ВМ, Рубенфельд ГД, Томпсон БТ, и другие; Целевая группа по определению ARDS. Острый респираторный дистресс-синдром: берлинское определение.  ДЖАМА . 2012;307(23):2526-2533. doi:10.1001/jama.2012.5669PubMedGoogle Scholar14.Заболевания почек: улучшение глобальных результатов (KDIGO) Рабочая группа по острой травме почек. Клиническое практическое руководство KDIGO при остром повреждении почек. Приложение для почек . 2012; 2:1. Google ScholarCrossref 15.Ли Кью, Гуань Х, Ву П, и другие. динамика ранней передачи в Ухане, Китай, пневмонии, инфицированной новым коронавирусом. [опубликовано 29 января 2020 г.]. N Engl J Med . 2020. doi:10.1056/NEJMoa2001316PubMedGoogle Scholar16.Zhang Х, Кан ZJ, Гонг ХИ, и другие. Пищеварительная система является потенциальным путем заражения 2019 nCoV: биоинформатический анализ, основанный на транскриптомах отдельных клеток. Препринт. Размещено в сети 31 января 2020 г.bioRxiv 927806. doi: 10.1101/2020.01.30.927806

Молекулярная эпидемиология и характеристики CTX-M-55, продуцирующей β-лактамазу расширенного спектра Escherichia coli Из Гуанчжоу, Китай

В последние годы в клинике постепенно увеличивалась положительная частота β-лактамаз расширенного спектра (БЛРС) СТХ-М-55. Для определения молекулярной эпидемиологии и характеристик bla CTX-M -55 -положительных изолятов у пациентов в двух больницах в Гуанчжоу было собрано в общей сложности 374 неповторяющихся штамма Escherichia coli , продуцирующих БЛРС. 89 bla CTX-M -55 -положительные изоляты были отобраны с помощью ПЦР-амплификации в группе CTX-M-1 и подтверждены секвенированием ДНК.Полногеномное секвенирование использовали для анализа фенотипа устойчивости, типов плазмид, филогенетических отношений и генетического окружения гена bla CTX-M -55 . Эксперименты по конъюгации и ПЦР проводили для подтверждения возможности переноса плазмиды, несущей ген bla CTX-M-55 . Результаты показали, что все bla CTX-M-55 -положительные изоляты были устойчивы к цефтриаксону, а 88,76 и 76,40% были устойчивы к цефтазидиму и цефепиму соответственно.Показатели резистентности к левофлоксацину и сульфаметоксазолу составили 66,29 и 59,55% соответственно. Однако уровень чувствительности пиперациллина/тазобактама, амоксициллина/клавуланата и амикацина превышал 90%. Все bla CTX-M-55 -положительные изоляты были чувствительны к карбапенемам. В bla CTX-M-55 -положительных изолятах было обнаружено 32 ST, среди которых частота обнаружения ST1193 была относительно высокой (19,10%, 17/89), а другие типы ST были рассеяны.Еще неизвестно, сможет ли ST1193, несущий ген bla CTX-M -55 , стать популярным штаммом-клоном в этом регионе в будущем. Типы плазмид, несущие ген bla CTX-M -55 , включали IncI1, IncFII, IncFIC, IncFIB, IncHI2, IncI2 и IncX/Y, среди которых плазмиды IncI1 и IncFII были основными плазмидами, на долю которых приходилось 37,80 и 28,09% соответственно. Среди них 11 штаммов плазмиды IncI1 существовали в штаммах ST1193.Ген bla CTX-M -55 был обнаружен на хромосомах 13 изолятов, и, по-видимому, его количество увеличивается с каждым годом. Было проанализировано до пяти различных типов генетической среды, окружающей ген bla CTX-M -55 . Наиболее распространенной была структура типа II «IS Ecp1 bla CTX-M -55 -ORF477″. В заключение остается открытым вопрос о том, будет ли ST1193, несущий ген bla CTX-M -55 , эпидемическим клоном этой области в будущем.Плазмиды IncI1 и IncFII, а также мобильные элементы, такие как IS Ecp1 и IS 26 , могут быть основными факторами, ведущими к распространению и преобладанию генотипов CTX-M-55.

Ключевые слова: СТХ-М-55; кишечная палочка; ИСЭкп1; плазмида IncFII; плазмида IncI1; СТ1193.

Требования к движениям и характеристики травм у игроков Университета регби до 20 лет

Антропометрические и физические показатели нападающих и защитников представлены в таблице 2.У спины были более низкие значения массы тела, толщины кожной складки, приседаний 1-RM, становой тяги 1-RM и пиковой мощности нижней части тела по сравнению с форвардами ( P < 0,05). Для средних еженедельных требований к движению спина имела более высокие значения для средней недельной общей дистанции ( P < 0,001), относительной дистанции ( P < 0,001), дистанции высокоинтенсивного бега (HIR) ( P < 0,001). ), спринтерская дистанция ( P < .001), высокоинтенсивное ускорение (HIA; P < .001), высокоинтенсивное замедление (HID; P < 0,001), столкновения ( P = 0,023), спринт ( P < 0,001) и высокоинтенсивное усилие ( P < 0,001). ), чем вперед.

Всего за сезон было зарегистрировано 45 травм в матчах MA (защитники = 12, нападающие = 33), из них 23 травмы NTL (защитники = 3, нападающие = 20) и 22 травмы TL (защитники = 9, нападающие = 13). ; Таблица 3). Сообщалось о дополнительных 3 тренировочных травмах MA (2 NTL, 1 TL).Частота травм в командных матчах составила 107,1 травм MA / 1000 PH (защитники = 61,2 / 1000 PH, нападающие = 147,3 / 1000 PH), 54,8 травм NTL / 1000 PH (защитники = 15,3 / 1000 PH, нападающие = 89,3 / 1000 PH) и 52,4 ТУ травм/1000 ПГ (спины = 45,9/1000 ПГ, нападающие = 58,0/1000 ПГ; таблица 2). Частота тренировочных травм составила 3,1 травм MA/1000 PH, 2,1 травм NTL/1000 PH и 1,0 травм TL/1000 PH. Тяжесть травм при травмах TL представлена ​​в таблице 2. В среднем, травмы TL были причиной 9,4 тренировочных или игровых дней (спина = 7.3, нападающие = 10,8) пропустил из-за травмы.

Множественные регрессионные модели показали, что увеличение массы тела игрока связано с увеличением МА (β = 0,526, R 2 = 0,277, P = 0,014, 95% ДИ = 0,019, 0,149), TL (β = 0,582, R 2 = 0,339, P = 0,006, 95% ДИ = 0,029, 0,148), MA костно-мышечной системы (β = 0,467, R 2

2 = 9,0341,

9,2 9034

, 0,2033, 95% ДИ = 0,005, 0,099), NTL опорно-двигательного аппарата (β = 0,593, R 2 = 0,351, P = 0,005, 95% ДИ = 0,02, 0,095), центральная нервная система (ЦНСМА) или периферическая нервная система (ПНС; β = 0,574, R 2 = 0,33, P = 0,006, 95% ДИ = 0,01, 0,056), НТЛ ЦНС или ПНС (β = 0,543, R 2

2 2 = 0,295, P = 0,011, 95% ДИ = 0,007, 0,045), NTL верхней конечности и туловища (β = 0,47, R 2 = 0,221, P = .004, 95% ДИ = 0,004, 0,076) и NTL нижних конечностей (β = 0,518, R 2 = 0,268, P = 0,016, 95% ДИ = 0,006, 0,048). Увеличение массы тела (β = 0,931, R 2 = 0,438, P = 0,002, 95% ДИ = 0,025, 0,088) и уменьшение толщины кожной складки (β = -0,704, R 8 2 , P = 0,011, 95% ДИ = -0,03, -0,004) были связаны с увеличением травм МА нижних конечностей.

PCA выявил 3 ПК (ПК1, ПК2, ПК3; рисунок).Считалось, что основной компонент 1 представляет собой общую производительность, учитывая, что он сильно нагружает большинство переменных GPS, за исключением относительного расстояния и спринта. Считалось, что основной компонент 2 представляет производительность HIR, но не влияет, учитывая, что он нагружает относительную дистанцию, спринт, общую высокоскоростную дистанцию ​​(сумма HIR и спринт), HIA и относительное высокоинтенсивное усилие, но отрицательно влияет на удары в зонах. 2-4, удар высокой интенсивности (HII) и нагрузка на тело. Считалось, что главная компонента 3 представляет удары, но не столкновения.Увеличение PC2 было связано со снижением NTL верхней конечности и туловища ( r = -0,32, P = 0,03), NTL опорно-двигательного аппарата ( r = -0,36, P = 0,05), NTL всего ( r = -0,46, P < .01), TL опорно-двигательного аппарата ( r = -0,30, P = .05), MA опорно-двигательного аппарата ( r = -0,41, ) и MA всего ( r = -0,48, P < 0,01) травм. Увеличение PC3 было связано с увеличением TL при травмах головы или шеи ( r = 0.32, P = 0,03) и МА головы или шеи ( r = 0,33, P = 0,03) (табл. 4).

студенческих эмпирических характеристических функций и их применение для проверки формы распределения | Биометрика

Получить помощь с доступом

Институциональный доступ

Доступ к контенту с ограниченным доступом в Oxford Academic часто предоставляется посредством институциональных подписок и покупок.Если вы являетесь членом учреждения с активной учетной записью, вы можете получить доступ к контенту следующими способами:

Доступ на основе IP

Как правило, доступ предоставляется через институциональную сеть к диапазону IP-адресов. Эта аутентификация происходит автоматически, и невозможно выйти из учетной записи с проверкой подлинности IP.

Войдите через свое учреждение

Выберите этот вариант, чтобы получить удаленный доступ за пределами вашего учреждения.

Технология Shibboleth/Open Athens используется для обеспечения единого входа между веб-сайтом вашего учебного заведения и Oxford Academic.

  1. Щелкните Войти через свое учреждение.
  2. Выберите свое учреждение из предоставленного списка, после чего вы перейдете на веб-сайт вашего учреждения для входа.
  3. Находясь на сайте учреждения, используйте учетные данные, предоставленные вашим учреждением.Не используйте личную учетную запись Oxford Academic.
  4. После успешного входа вы вернетесь в Oxford Academic.

Если вашего учреждения нет в списке или вы не можете войти на веб-сайт своего учреждения, обратитесь к своему библиотекарю или администратору.

Вход с помощью читательского билета

Введите номер своего читательского билета, чтобы войти в систему. Если вы не можете войти в систему, обратитесь к своему библиотекарю.

Члены общества

Многие общества предлагают своим членам доступ к своим журналам с помощью единого входа между веб-сайтом общества и Oxford Academic. Из журнала Oxford Academic:

  1. Щелкните Войти через сайт сообщества.
  2. При посещении сайта общества используйте учетные данные, предоставленные этим обществом. Не используйте личную учетную запись Oxford Academic.
  3. После успешного входа вы вернетесь в Oxford Academic.

Если у вас нет учетной записи сообщества или вы забыли свое имя пользователя или пароль, обратитесь в свое общество.

Некоторые общества используют личные аккаунты Oxford Academic для своих членов.

Личный кабинет

Личную учетную запись можно использовать для получения оповещений по электронной почте, сохранения результатов поиска, покупки контента и активации подписок.

Некоторые общества используют личные учетные записи Oxford Academic для предоставления доступа своим членам.

Институциональная администрация

Для библиотекарей и администраторов ваша личная учетная запись также предоставляет доступ к управлению институциональной учетной записью. Здесь вы найдете параметры для просмотра и активации подписок, управления институциональными настройками и параметрами доступа, доступа к статистике использования и т. д.

Просмотр учетных записей, в которые вы вошли

Вы можете одновременно войти в свою личную учетную запись и учетную запись своего учреждения.Щелкните значок учетной записи в левом верхнем углу, чтобы просмотреть учетные записи, в которые вы вошли, и получить доступ к функциям управления учетной записью.

Выполнен вход, но нет доступа к содержимому

Oxford Academic предлагает широкий ассортимент продукции. Подписка учреждения может не распространяться на контент, к которому вы пытаетесь получить доступ. Если вы считаете, что у вас должен быть доступ к этому контенту, обратитесь к своему библиотекарю.

COE — Характеристики учащихся высших учебных заведений

Высшее образование

Характеристики учащихся высших учебных заведений

Осенью 2019 года около 74 процентов из 11.0 миллионов студентов бакалавриата в 4-летних учреждениях были зачислены на полный рабочий день по сравнению с 37 процентами из 5,6 миллионов студентов бакалавриата в 2-годичных учреждениях.

Осенью 2019 года 16,6 миллиона студентов бакалавриата и 3,1 миллиона студентов со степенью бакалавра (аспиранта) посещали высшие учебные заведения США, присуждающие степень. 1 , 2 Если не указано иное, регистрация включает как U.S. студенты-резиденты и иностранные студенты-нерезиденты. Характеристики студентов, такие как их возраст, раса или этническая принадлежность, варьировались в зависимости от государственных, частных некоммерческих и частных коммерческих 2- и 4-летних учебных заведений.

Выберите подгруппу:
Показать все доступные выводы

Выберите характеристику подгруппы из раскрывающегося меню ниже, чтобы просмотреть соответствующий текст и рисунки.

Уровень учреждения + Контроль учреждения

+

Примерно 11.Осенью 2019 года 0 миллионов (66 процентов) студентов бакалавриата посещали четырехлетние учебные заведения, а 5,6 миллиона (34 процента) посещали двухгодичные учебные заведения. Из числа студентов четырехгодичных учебных заведений 8,2 миллиона (74 процента) посещали дневное и 2,8 миллиона (26 процентов) посещали неполный рабочий день. Из студентов бакалавриата в двухгодичных учебных заведениях 2,1 миллиона (37 процентов) посещали очную форму обучения, а 3,5 миллиона (63 процента) — неполный рабочий день.

Фигура 1.Процентное распределение резидентов США, зачисленных на бакалавриат в высшие учебные заведения, присуждающие степень, по уровню и контролю учебного заведения, а также расе или этнической принадлежности студентов: осень 2019 г.

Осенью 2019 года распределение студентов-резидентов бакалавриата в США (дневных и заочных) по расовым или этническим группам варьировалось между государственными, частными некоммерческими и частными коммерческими учреждениями, а также между 2- и 4-летними учебными заведениями. 3 В 4-летних учебных заведениях процент белых студентов бакалавриата был самым высоким в частных некоммерческих учреждениях (63 процента), процент чернокожих студентов был самым высоким в частных коммерческих учреждениях (29 процентов), а процент Латиноамериканские и азиатские студенты были самыми высокими в государственных учреждениях (20 и 8 процентов, соответственно). В частности, 63 процента студентов бакалавриата в частных некоммерческих учреждениях, которые были белыми, были выше, чем проценты в государственных (55 процентов) и частных коммерческих (43 процента) учреждениях.Процент чернокожих студентов бакалавриата в частных коммерческих учреждениях (29 процентов) более чем вдвое превышал процент в частных некоммерческих (12 процентов) и государственных (11 процентов) учреждениях. Процент студентов бакалавриата, которые были латиноамериканцами, был выше в государственных учреждениях (20 процентов), чем в частных коммерческих и некоммерческих учреждениях (18 и 13 процентов, соответственно). Доля студентов бакалавриата в государственных и частных некоммерческих учреждениях азиатского происхождения (8 и 6 процентов соответственно) была выше, чем доля в частных коммерческих учреждениях (4 процента).

Осенью 2019 года в двухгодичных учебных заведениях процент студентов бакалавриата, проживающих на дневном и неполном рабочем дне в государственных учреждениях, которые были белыми или азиатами (47 и 6 процентов соответственно), был выше, чем процент в частных некоммерческих организациях (41 и 3 процента). процентов соответственно) и частных коммерческих (33 и 4 процента соответственно) учреждений. Напротив, процент чернокожих студентов бакалавриата в частных некоммерческих учреждениях (41 процент) был выше, чем процент в частных коммерческих и государственных учреждениях (28 и 14 процентов соответственно).Процент студентов бакалавриата в частных коммерческих и государственных учреждениях, которые были латиноамериканцами (29 и 28 процентов, соответственно), был выше, чем процент в частных некоммерческих учреждениях (10 процентов).

Рисунок 2. Процентное распределение числа студентов, обучающихся на дневном отделении бакалавриата в высших учебных заведениях, присуждающих степень, по уровню и контролю учебного заведения и возрасту студентов: осень 2019 г.

Среди 4-летних учебных заведений осенью 2019 года частные коммерческие учреждения выделялись по доле своих студентов очной формы обучения, которые были старше.Доля студентов очной формы обучения в возрасте до 25 лет была выше в государственных учреждениях (90 процентов) и частных некоммерческих учреждениях (86 процентов), чем в частных коммерческих учреждениях (34 процента). 4 Доля студентов очной формы обучения в возрасте от 25 до 34 лет в государственных и частных некоммерческих организациях составила 7 и 8 процентов соответственно. Напротив, в частных коммерческих учебных заведениях студенты бакалавриата в возрасте от 25 до 34 лет составляют самую большую возрастную группу среди тех, кто обучается на дневном отделении (38 процентов).

Осенью 2019 года в двухгодичных учебных заведениях частные учреждения, как некоммерческие, так и коммерческие, обслуживали большую часть старших студентов очной формы обучения. Процент студентов очной формы обучения в возрасте до 25 лет был выше в государственных учреждениях (80 процентов), чем в частных коммерческих (45 процентов) и частных некоммерческих (42 процента) учреждениях. Напротив, процент студентов очной формы обучения в возрасте 35 лет и старше был ниже в государственных учреждениях (7 процентов), чем в частных коммерческих (20 процентов) и частных некоммерческих (23 процента) учреждениях.

Рисунок 3. Процентное распределение зачисления в бакалавриат с частичной занятостью в высших учебных заведениях, присуждающих степень, по уровню и контролю учебного заведения и возрасту студентов: осень 2019 г.

Распределение студентов-заочников включало более высокий процент старшеклассников, чем студентов-очников. Осенью 2019 года в 4-летних учебных заведениях процент студентов-заочников бакалавриата в возрасте до 25 лет был выше в государственных учреждениях (60 процентов), чем в частных некоммерческих (41 процент) и частных коммерческих (18 процентов) учреждениях.Процент студентов-заочников в возрасте от 25 до 34 лет был ниже в государственных (24%) и частных некоммерческих (29%) учебных заведениях, чем в частных коммерческих (41%). Процент студентов-заочников в возрасте 35 лет и старше был ниже в государственных учреждениях (16 процентов), чем в частных некоммерческих (30 процентов) и частных коммерческих (41 процент) учреждениях.

Осенью 2019 года в двухгодичных учебных заведениях процент студентов-заочников бакалавриата в возрасте до 25 лет был выше в государственных учреждениях (63 процента), чем в частных некоммерческих (35 процентов) и частных коммерческих (33 процента) учреждениях.Процент студентов-заочников в возрасте от 25 до 34 лет был ниже в государственных учреждениях (21 процент), чем в частных некоммерческих (35 процентов) и частных коммерческих (39 процентов) учреждениях. Точно так же процент студентов-заочников в возрасте 35 лет и старше был ниже в государственных учреждениях (16 процентов), чем в частных коммерческих (28 процентов) и частных некоммерческих (29 процентов) учреждениях.

Рисунок 4.Процентное распределение числа жителей США, зачисленных после получения степени бакалавра в высшие учебные заведения, присуждающие степень, в зависимости от контроля учебного заведения и расовой или этнической принадлежности студентов: осень 2019 г.

Осенью 2019 года около 49 процентов всех студентов, получивших степень бакалавра (выпускников), посещали государственные учебные заведения, 44 процента посещали частные некоммерческие учреждения и 8 процентов посещали частные коммерческие учреждения. Процент чернокожих аспирантов в частных коммерческих учреждениях (32 процента) более чем вдвое превышал процент в частных некоммерческих учреждениях и государственных учреждениях (13 и 11 процентов соответственно).Почти две трети аспирантов-резидентов в государственных и частных некоммерческих учреждениях США были белыми (65 и 62 процента соответственно) по сравнению с менее чем половиной студентов частных коммерческих учреждений (46 процентов). Латиноамериканские студенты составляли 12 процентов аспирантов в государственных учреждениях и по 11 процентов в частных коммерческих и частных некоммерческих учреждениях. Азиатские студенты составляют 9 процентов от общего числа аспирантов в частных некоммерческих учреждениях, 8 процентов в государственных учреждениях и 6 процентов в частных коммерческих учреждениях.

Рисунок 5. Процентное распределение числа студентов, обучающихся после получения степени бакалавра на дневном или заочном отделении в высших учебных заведениях, присуждающих степень, в зависимости от учебного заведения и возраста учащихся: осень 2019 г.

Осенью 2019 года примерно три четверти студентов очной формы обучения в государственных учебных заведениях были моложе 30 лет, из них 38 процентов — моложе 25 лет и 36 процентов — в возрасте от 25 до 29 лет.Большинство (68 процентов) аспирантов дневной формы обучения также были моложе 30 лет в частных некоммерческих учреждениях, 32 процента — моложе 25 лет и 36 процентов — в возрасте от 25 до 29 лет. Напротив, более двух третей (71 процент) 5 аспирантов очных отделений частных коммерческих учебных заведений были в возрасте 30 лет и старше, из них 33 процента в возрасте от 30 до 39 лет и 37 процентов в возрасте 40 лет и старше. Среди аспирантов, занятых неполный рабочий день, 79 процентов были в возрасте 30 лет и старше в частных коммерческих учреждениях, а также 63 процента в частных некоммерческих учреждениях и 60 процентов в государственных учреждениях.


Дополнительная информация

Таблица 303.50 (Дайджест 2020 г.): Общее осеннее зачисление в высшие учебные заведения, присуждающие ученую степень, в разбивке по уровню зачисления, контролю и уровню учебного заведения, статусу посещаемости и возрасту студента: 2019 г.; Таблица 303.60 (Дайджест 2020 г.): Общее осеннее зачисление в высшие учебные заведения, присуждающие ученую степень, в разбивке по уровню зачисления, полу учащегося, уровню и контролю учебного заведения, а также статусу посещаемости учащегося: 2019 г.; Таблица 306.50 (Дайджест 2020 г.): Общее осеннее зачисление в высшие учебные заведения, присуждающие ученую степень, в разбивке по контролю и классификации учебных заведений, уровню зачисления и расовой/этнической принадлежности студентов: 2019 г.; Таблица 306.50 (Дайджест 2019 г.): Общее осеннее зачисление в высшие учебные заведения, присуждающие ученую степень, в разбивке по контролю и классификации учебных заведений, уровню зачисления и расовой/этнической принадлежности учащихся: 2018 г.

ЗАКРЫТЬ

Характеристические корни класса дробных осцилляторов

Основная теорема алгебры определяет число характеристических корней обыкновенного дифференциального уравнения целого порядка.Это может перестать быть верным для дифференциального уравнения дробного порядка. Приведенные в статье результаты позволяют предположить, что число характеристических корней класса осцилляторов дробного порядка, вообще говоря, может быть бесконечно велико. Далее мы делаем вывод, что это может иметь место и для характеристических корней дифференциального уравнения дробного порядка выше 1. Рассмотрена связь между диапазоном дробного порядка и расположением характеристических корней осцилляторов на комплексной плоскости.

1. Введение

Генераторы являются важным компонентом устройств в системах электрон-позитронных коллайдеров (см., например, Zhao et al. [1], Ma et al. [2], Zang et al. [3], Ding et al. и др. [4], Мардер и др. [5], Баррозу [6], Миллер и др. [7] и Лемке [8], просто цитирую некоторых). Собственно говоря, осцилляции — явления, широко наблюдаемые в науках и технике, относящихся к физике высоких энергий (см., например, Ахмедиева и др. [9], Бачаса [10], Винтера и др. [11], Додонова [12]. , Tan [13], Diamandis et al.[14], Гринвальд и соавт. [15], Мэтьюз и др. [16], Faiman [17], Cocho et al. [18], Бальдиотти и соавт. [19], Кю Шин [20], Кирсон [21], Клемент [22], Сикстрём и др. [23], Асгари и соавт. [24], Ум и др. [25], Бахар и Ясук [26], Хассанабади и др. [27], Бхаттачарья и Рой [28], а также Саад и др. [29], просто упомянув несколько).

Существуют различные структуры осцилляторов, такие как осциллятор Матье (Флорис [30]), осциллятор типа Льенара (Яшар [31]), релятивистский осциллятор (Осборн [32]), осциллятор типа уравнения Шредингера (Корнуолл и Тиктопулос [33] ) и осциллятор Дуффинга (Baltanás et al.[34] и Эртюрк и Инман [35]). На самом деле осцилляторы играют роль в различных областях, от экспериментальной физики до электроники (см., например, Райли и др. [36], Сунг и Григориу [37], Харрис [38], Папулис [39], Бендат и др.). Пирсол [40], Девасахаям [41], Карренберг [42], Эдсон [43] и Балабан и др. [44]).

Это исследование относится к области дробных генераторов, которые вызывают растущий интерес физиков и инженеров. Более конкретно, мы стремимся выявить специфические свойства характеристических корней класса дробных осцилляторов.При этом сначала рассмотрим обыкновенное дифференциальное уравнение порядка, заданного формулой где – натуральное число, а – любое комплексное число. Мы всегда предполагаем, что по крайней мере один из старших коэффициентов для . Характеристическое уравнение (1) имеет вид

Основная теорема алгебры гласит, что число корней уравнения (2) равно (Г. А. Корн и Т. М. Корн [45]). Эта теорема сформулирована в области комплексных переменных (Кранц [46]).

Предположим, что корни .Для каждого корня кратности, действительного или комплексного, мы всегда рассматриваем корни в дальнейшем, если не указано иное. Используя разложение частичной дроби, можно выразить как

Теперь перепишем (3) следующим выражением: где , , , и – константы. Не ограничивая общности, мы можем предположить, что единственный простой нуль у нечетен.

Множитель в (4) соответствует уравнению осциллятора в виде

Характеристическое уравнение (5) имеет вид

Существует два класса дробных осцилляторов.Один из них имеет вид (Рябов и Пузенко [47, уравнение (1)], Ахмад и др. [48], Радван и др. [49], Дроздов [50, уравнение (9)], Тофиги и Пур [ 51], Тофиги [52, уравнение (2)], Блащик и др. [53, уравнение (10)] и Нарахари Ачар и др. [54, 55])

Другой выражается в форме (Лим и др. [56–58], Мунианди и Лим [59], Эаб и Лим [60] и Ли и др. [61]) В этом исследовании используется форма (8).

Согласно основной теореме алгебры характеристических корней относительно осцилляторного уравнения (5) всего два.Они есть

Можно было бы небрежно ошибиться, полагая, что существуют только два характеристических корня относительно уравнения дробного осциллятора (8), потому что

Однако мы покажем, что количество корней в приведенном выше выражении резко отличается от числа корней в следующем выражении:

Вклад этой статьи двоякий. Одна состоит в том, чтобы показать, что число характеристических корней уравнения (8), вообще говоря, бесконечно велико.Другой — выявить взаимосвязь между диапазоном и расположением характеристических корней (8) на комплексной плоскости. Кроме того, если все () являются простой комплексной парой корней, обыкновенное дифференциальное уравнение порядка (1) и его обобщение, заданное формулой может быть взято как произведение осцилляторов целочисленного порядка и дробного порядка последовательно в широком смысле на четность соответственно.

Остальная часть статьи организована следующим образом. Мы приведем результаты в разделе 2, включая доказательство существования бесконечных характеристических корней относительно (8) и объяснение того, что (1) и (12) могут быть взяты в качестве осцилляторов в ряду в широком смысле.Обсуждения приведены в разделе 3, за которым следуют выводы.

2. Результаты
2.1. Результат 1

Число характеристических корней уравнения (8) может быть бесконечно большим.

Обозначим через C набор комплексных чисел. Позволять . Предположим, что степенная функция задается выражением

Затем количество различных значений зависит от значения для данного . Точнее, мы выражаем это с помощью следующих лемм, которые можно найти в литературе, например, в [45] или Ю [62].

Лемма 1. Если — рациональное число, выраженное неприводимой дробью , где , число значений равно .

Лемма 2. Если    иррациональное или мнимое число, то число значений бесконечно велико.

Общее выражение имеет вид Поэтому из леммы 2 имеем следующую теорему.

Теорема 3. Число характеристических корней дробного осциллятора (8) бесконечно велико, если .

Доказательство. Пусть = 0. Тогда характеристические корни в (9) становятся мнимыми числами, выраженными формулой

Согласно лемме 2 число корней или бесконечно велико. Таким образом, получается теорема 3.

2.2. Результат 2

Уравнения (1) и (12) можно рассматривать как последовательные осцилляторы.

Обозначим в (4) через :

Без ограничения общности предполагается четным. Кроме того, мы предполагаем, что все () являются простой комплексной парой корней.Тогда у нас есть следующая теорема.

Теорема 4. Обыкновенное дифференциальное уравнение (1) можно рассматривать как осциллятор (т. е. произведение осцилляторов) в широком смысле, если оно четно и все () являются простой комплексной парой корней. В широком смысле подразумевается, что это система, состоящая из произведения ряда обычных осцилляторов 2-го порядка.

Доказательство. С одной стороны, обозначает характеристическое уравнение осциллятора 2-го порядка, т.к. четно и все () являются простой комплексной парой корней.С другой стороны, характеристическое уравнение (1) может быть выражено как

На основании теории проектирования фильтров (Митра и Кайзер [63]) система (1) в случае четности может быть выражена на рисунке 1.


Следовательно, система (1) может быть выражена произведением ряда осцилляторов 2-го порядка.

Обозначим через характеристическое уравнение (12). Потом, куда

Таким образом, система дробного порядка, выраженная формулой (12), может быть произведением ряда дробных осцилляторов (8).

3. Обсуждения

В предыдущем разделе говорилось, что в if бесконечные корни. В случае сводится к характеристическому уравнению обычного осциллятора (5) только с двумя корнями. Таким образом, дробь резко изменяет поведение характеристических корней осцилляторов. Для облегчения наших рассуждений мы опускаем нижний индекс в дальнейшем, чтобы не путать. Точнее, мы специально рассматриваем дробный осциллятор в виде

На рис. 2 показана последовательно включенная резонансная цепь RLC, где , и обозначают резистор, катушку индуктивности и емкость соответственно.На рисунке 2 представлены электронный ток и источник питания. Согласно закону напряжения Кирхгофа,


Пусть и . Обозначить через . Тогда (21) принимает вид

Обобщение (22) на дробный порядок дает

Ниже мы специально исследуем схему на рис. 2 с , как показано на рис. 3.


В случае рис. 3 (23) принимает вид

Обозначим через функцию импульсного отклика (24).Тогда, используя технику дробного исчисления и дифференциальных уравнений [64–81], имеем (подробности см. в [61]) где – функция Бесселя первого рода порядка.

Следующие теоремы отражают особенность корней .

Теорема 5. Если , то все корни лежат в левой части комплексной плоскости.

Доказательство. Обратите внимание, что

Из вышеизложенного имеем асимптотику в виде

Применение (27) к (25) дает

Обозначим через преобразование Лапласа .Тогда по теореме о конечном значении имеем

Из вышеизложенного следует, что все полюса, кроме начала координат, находятся строго в левой части плоскости. Справа от плоскости аналитический. Это завершает доказательство.

Теорема 6. Если хотя бы части корней лежат в правой части комплексной плоскости.

Доказательство. Обратите внимание, что Из вышеизложенного имеем следующее:

Так как подразумевается , мы сразу видим, что и правая, и левая части приведенного выше выражения соответственно неограничены, когда .Таким образом, при дробный осциллятор (24) неустойчив согласно теории систем (Гейбл и Робертс [77], Дорф и Бишоп [78]). Следовательно, по крайней мере, некоторые из полюсов находятся справа от плоскости. Следовательно, по крайней мере, части корней располагаются в правой части комплексной плоскости.

В большинстве предыдущих рассуждений осцилляторы дробного порядка (24) рассматривались как конкретный объект. Заметим, что число характеристических корней дифференциального уравнения вообще в виде (12) также может быть бесконечно большим.Отсюда попутно получается следующая теорема.

Теорема 7. Дифференциальное уравнение дробного порядка, выраженное формулой (12), имеет бесконечные характеристические корни, если и если существует хотя бы пара простых комплексных корней.

Доказательство. Характеристическое уравнение (12) может быть разложено в виде (18) в силу . Поскольку существует по крайней мере пара простых комплексных корней, число характеристических корней (19) бесконечно велико.Таким образом, число характеристических корней уравнения (12) бесконечно велико. Это завершает доказательство.

Предыдущие обсуждения показывают интересные явления характеристических корней осцилляторов дробного типа (24). В будущем мы будем работать над изучением ответов на вопросы, описанные ниже. (i) Все ли полюсы по отношению к (24) находятся справа от плоскости, когда ? (ii) Может ли иметь место интересное колебательное поведение (12 ) если все в (18) и если четно?

4.Выводы

Мы выяснили, что число характеристических корней осцилляторов дробного порядка уравнения (24) обычно бесконечно велико. Этот вывод был далее сделан для случая дифференциального уравнения дробного порядка (12). Мы показали, что все характеристические корни (24) строго расположены в левой части комплексной плоскости, если и хотя бы некоторые из характеристических корней (24) лежат в правой части комплексной плоскости, если . В случае , (24) свести к обычному незатухающему осциллятору.

Благодарности

Эта работа была частично поддержана Национальным фондом естественных наук Китая (NSFC) в рамках проекта Грант №. 61272402, 61070214, 60873264 и план 973 по проекту №. 2011CB302800.

Характеристики интернет-зависимости/патологического использования Интернета у студентов университетов США: исследование с использованием качественного метода

Описательные результаты

Участники описали свои текущие модели использования Интернета в отношении ежедневного количества времени, которое они проводили в Интернете, и самого продолжительного периода, который они когда-либо проводили в Интернете за один непрерывный сеанс использования.Количество времени, которое учащиеся ежедневно проводят в Интернете, варьировалось от 5 часов до «весь день» из-за широкого использования мобильных устройств (например, смартфонов и планшетных компьютеров) с охватом данных (например, «Я чувствую, что я по телефону все время постоянно проверяю»). Многие участники отметили, что они не могут точно отличить количество времени, проведенного в Интернете для школьных занятий или связанных с работой целей, от времени, проведенного в других целях (например, «Если я пишу статью, тогда у меня открыт браузер или я на телефоне»).Самый продолжительный период времени, который участники проводили в Интернете за один непрерывный сеанс, варьировался от 3 часов до всего дня (например, «Как только наступит лето, я буду в нем [Интернете], например, целый день»). Во время этих сессий участники рассказывали о том, что занимались различными видами деятельности, включая покупки в Интернете, просмотр видео и просмотр веб-сайтов. Другие участники описали использование определенного приложения в течение длительного периода времени, включая видеоигры и просмотр видео (например, телешоу и фильмов) в Интернете.

Возраст, в котором участники сообщили, что они впервые вышли в Интернет, варьировался от 6 до 19 лет, при этом средний возраст составлял 9 лет (SD = 2,7). Возраст, в котором участники сообщили, что они впервые подумали, что у них проблемы с чрезмерным использованием Интернета, варьировался от 10 до 32 лет, при этом средний возраст возникновения проблем составлял 16 лет (SD = 4,3). В Таблице 2 представлены характеристики IA/PIU, о которых сообщали сами участники.

Почти половина (48,1%, N = 13) учащихся из выборки набрали пять или более баллов по диагностическому опроснику Янга (YDQ) и, следовательно, набрали больше предложенного порогового значения для IA.Еще 40,7% (N = 11) набрали три или четыре балла по шкале YDQ, что отражает предлагаемое отсечение для подпорогового ИА. Практически вся выборка превышала рекомендуемый порог компульсивного использования Интернета в соответствии со Шкалой компульсивного использования Интернета (CIUS). Более половины (63,0%, N = 17) студентов сообщили об использовании Интернета для отвлечения от проблем или снятия плохого настроения. Что касается негативных последствий интенсивного использования Интернета, то на депривацию сна указали 63,0% (N = 17) студентов; 44,4% (N = 12) сообщили, что пренебрегают учебой и другими повседневными обязанностями из-за интенсивного использования Интернета.Корреляция между YDQ и CIUS составила 0,79.

Качественные результаты

В ходе фокус-групп были выявлены три всеобъемлющие темы, касающиеся: а) факторов, провоцирующих использование Интернета для целей, не связанных с учёбой или работой, б) деятельности, связанной с Интернетом, и в) последствий чрезмерного использования Интернета. На рис. 1 показана диаграмма со всеми качественными темами и подтемами, см. рис. 1. Для контекстуализации цитат указаны пол и раса участников фокус-группы. Для удобства читателя участникам были даны псевдонимы, чтобы можно было идентифицировать цитаты, данные одним и тем же человеком.

Тема 1: Факторы, провоцирующие использование Интернета . Эта тема характеризовалась эмоциональными, межличностными и ситуационными факторами, которые усиливают желание студентов использовать Интернет для целей, не связанных с учёбой и работой. Подтемы включали: а) настроение и чувства, б) скуку и в) стресс и эскапизм. Многие участники отметили, что более чем один из этих факторов способствовал их чрезмерному использованию Интернета в разное время.

Для некоторых участников чрезмерное использование Интернета было вызвано сильными чувствами и настроением.Для некоторых самые сильные побуждения пришли с положительными эмоциями (например, «Когда я безумно счастлив, я хочу, чтобы мои друзья знали об этом. Я чувствую, что хочу опубликовать это на Facebook» [«Эндрю», белый мужчина]). Для других негативные эмоции были более сильным триггером (например, «Если у меня выдался плохой день, я заслуживаю награды вроде…» [«Лили», азиатка]). Независимо от валентности эмоции, большинство участников отметили, что определенные чувства и настроения вызывают желание участвовать в определенных действиях в Интернете. «Нэнси», азиатская женщина, описала свое желание использовать определенное интернет-приложение в качестве механизма преодоления грусти:

Если я действительно в депрессии, я не попаду в Facebook, я не хочу ни с кем разговаривать.Я не буду использовать что-то вроде социальных сетей, но я определенно зайду на что-то вроде Tumblr, чтобы посмотреть на забавные вещи в течение часа.

Другие учащиеся обнаружили, что чаще используют социальные сети во время межличностных конфликтов, чтобы справиться со своим беспокойством по поводу конфликта. В то время как некоторые участники сообщили, что «постоянно обновляют свой статус», другие сообщили, что проверяют статус других. «Джесси», афроамериканка, отметила:

Если у меня когда-нибудь возникнет с кем-то ссора, напряжение или драма… Я просто зайду на Facebook, чтобы узнать, сказали ли они что-нибудь о своем настроении, обо мне в частности или что-то в этом роде.

Кроме того, у участников было разное желание использования в зависимости от настроения, причем некоторые из них лучше осознавали эти модели, чем другие. «Алиса», азиатка, рассказала о своих способах употребления с момента поступления в колледж, заявив:

Я обнаружил, что чаще захожу в Интернет, когда мне грустно, чем весело. Когда мне грустно, я просто хочу поговорить с другом из-за границы по междугороднему телефону или что-то в этом роде. Поэтому я просто общаюсь с ними онлайн. А когда я счастлив, я обычно не выхожу в интернет.

Многие участники сообщили, что скука вызвала у них желание пользоваться Интернетом. Студенты обсудили Интернет как свою основную стратегию борьбы со скукой. «Том», белый мужчина, описал свой опыт так: «Если мне становится скучно, я первым делом иду туда». Другие, по-видимому, связывали Интернет с конкретными видами избавления от скуки (например, смехом, общением с другими и поиском информации). «Майк, — заявил афроамериканец, — всякий раз, когда мне скучно или я чувствую стресс, я просто захожу в Интернет, чтобы расслабиться, может быть, посмеяться или посмеяться.Для участников, включая «Майка», Интернет был средством облегчения всякий раз, когда возникала скука из-за легкого доступа на мобильных устройствах с покрытием данных: «Я думаю, когда вам становится скучно, вы всегда хотите войти в эту штуку; например, едешь на автобусе в класс, тебе скучно, у тебя нет друзей, ты просто идешь, потому что тебе скучно».

В дополнение к настроению, чувствам и скуке школьные и межличностные стрессоры вызвали у учащихся желание пользоваться Интернетом. «Сью», азиатская женщина, сообщила о желании «избегать вещей, поэтому я захожу в Интернет.Вам не нужно ни о чем думать. Вы просто смотрите и принимаете это». Для некоторых Интернет был ограниченным по времени перерывом:

Я думаю для себя, например, когда я действительно напряжен из-за учебы, когда мне нужен перерыв или у меня есть проблема Я обычно иду к компьютеру, чтобы уйти от школы, отвлечься от проблемы на час или два [«Джесси», афроамериканка].

Для других время, проведенное в Интернете, было труднее контролировать, и в конечном итоге это усилило их первоначальный стресс:

Я такой: если я сижу в Интернете 8 часов и ничего не делаю, я нахожусь в состоянии стресса и говорю себе: «Как ты мог это сделать, тратить столько времени?» Я злюсь на себя, но потом, потому что я раздражен, я ищу что-нибудь смешное, над чем можно посмеяться [Сью, азиатка].

Некоторые участники отметили желание избежать обязательств как триггер для использования Интернета. «Сара», азиатка, описала это желание так: «Для меня, как и для прокрастинации, я не хочу делать ничего другого, поэтому я просто иногда хочу просто развлечься. Я не хочу делать домашнее задание».

Тема 2: Деятельность, связанная с Интернетом . В этой теме описываются любимые участниками онлайн-действия и причины, по которым они получают удовольствие от этих действий.Многие участники занимались несколькими видами деятельности в Интернете. Подтемы включали: а) социальные сети, б) работу в школе и в) другие виды деятельности в Интернете.

Большинство участников сообщили об использовании той или иной формы социальных сетей. Социальные сети включают такие приложения, как Facebook, Twitter, Pinterest и Tumblr. Из-за доступности сайтов социальных сетей на мобильных устройствах многие участники отметили их использование как часть своей повседневной жизни (например, «Если я не сплю, то я сижу в Twitter или Facebook на своем телефоне… весь день» [«Лидия», афроамериканка]).Степень ежедневного использования варьировалась от случайного (например, «Что касается меня, мне нравится делиться мыслями, идеями или настроением с подписчиками в Твиттере или Facebook. Например, когда вы о чем-то думаете, вы говорите: «О, я напишу это в Твиттере» [«Джесси», афроамериканка]) до компульсивного (например, «У меня вошло в привычку, когда я просыпаюсь утром, первое, что я делаю, — это проверяю Facebook, например, несколько раз. Если вы этого не сделаете, это, вы почувствуете, что что-то упускаете» [«Сью», азиатка]). Появление нескольких сайтов социальных сетей дает пользователям множество каналов для связи со своими сверстниками.Некоторые участники описали использование нескольких сайтов социальных сетей. «Шэрон», афроамериканка, так описала свое использование:

Большую часть времени мне нравится обновлять свою ленту новостей на Facebook или смотреть на своих подписчиков в Twitter, чтобы узнать, о чем все говорят, и [если] люди публикуют драматический статус [в Twitter], тогда я перейдите по ссылкам на их профили [Facebook] и посмотрите, что они опубликовали.

Другие участники, такие как «Кристиан», афроамериканка, сообщили об очень интенсивном использовании одного сайта:

Бывают дни, когда я твитнул 100 раз… Я встаю и проверяю Твиттер, или когда я сажусь в автобус на урок, я проверяю Твиттер, или в классе я проверяю Твиттер, и во время обеда я проверю Твиттер, а перед сном проверю Твиттер.

Хотя некоторые участники подчеркнули важность социальных сетей в их повседневной жизни, многие поспешили указать на практические, связанные с работой функции, которые выполняет Интернет. Как проницательно заметила афроамериканка «Кристиан»: «Интернет — это не только Facebook, Twitter и Pinterest, но также и электронная почта, и Google, и библиотечная база данных в Интернете». На самом деле, многие студенты сообщили, что преподаватели требовали от студентов использования Интернета для выполнения назначенной им учебной работы, включая ведение блогов, участие в онлайн-классах и доступ к материалам виртуального класса.«Мэтт», мужчина азиатского происхождения, очень положительно оценил важность Интернета для своего образования, заявив: «Мое исследование требует конкретной информации, которую Интернет довольно удобно предоставляет. Для меня качество жизни повышается». Другие участники были двойственны, заявляя, что доступ к школьной работе/материалам, связанным с работой, в Интернете был одновременно и помощью, и помехой. «Кристиан», афроамериканка, отметила: «Вы есть на Facebook, и в Google, и в своей электронной почте, и в Twitter, и вы пишете статью, и вы что-то читаете.Это все равно, что постоянно двигаться». В целом участники признали удобство и необходимость Интернета как части университетской среды. «Кейт», белая женщина, заявила: «Я часто пользуюсь Интернетом в основном для занятий и разъяснения тем. Выключите интернет полностью, я не знаю, как выжить в университетских условиях».

Последняя подтема, «другая деятельность в Интернете», включала развлекательные мероприятия, такие как просмотр видеопотоков, онлайн-видеоигры, просмотр развлечений, социальные сети и новостные веб-сайты, размещение сообщений на форумах (например,г., Reddit) и общий поиск. Эти действия, как правило, проводились в сочетании с работой и/или социальными сетями. «Анжела», афроамериканка, сообщила: «Я слушаю музыку в Интернете, когда делаю домашнее задание, убираюсь в своей комнате или играю в Zelda (видеоигра), или смотрю, как другие онлайн играют в Zelda на в то же время.» Другие участники одновременно занимались только одним видом деятельности, говоря, что они предпочитают одни виды деятельности другим. Примеры включают поиск новостей («Я думаю, что мой главный источник новостей — Интернет.Я читаю 3 или 4 газеты в своей ленте, и это очень важно» [«Мэтт», азиат]), онлайн-игры («Я играю со случайными людьми в Интернете и общаюсь с ними, например, когда я играю баскетбольные игры. Вы как бы просто играете в них и играете в них» [«Том», белый мужчина]), и потоковое видео («Для меня тратить больше времени на просмотр фильмов и шоу, чем на социальные сети. времени, от просмотра фильмов до других занятий» [«Мэтт», мужчина азиатского происхождения]). «Клэр», белая женщина, сообщила, что онлайн-покупки были особенно привлекательными, заявив: «Я ненавижу ходить в торговый центр и ненавижу примерять одежду, теперь мне это не нужно.Это прямо там, в сети». Независимо от вида деятельности подтема «другая деятельность в Интернете» подчеркивает широко распространенную полезность и привлекательность Интернета, но также подчеркивает риск потенциально проблемного использования Интернета.

Независимо от того, используют ли учащиеся Интернет для улучшения межличностных связей и общения в социальных сетях, учебы или отдыха, Интернет предлагает множество легкодоступных вариантов, поощряющих постоянное использование. На самом деле студенты отметили, что сверстники и преподаватели облегчают и укрепляют их использование Интернета, что, следовательно, может быть потенциальным риском для тех, кто более подвержен риску развития IA/PIU.«Кейт», белая женщина, так описала ожидания других: «Что касается проверки моей электронной почты, это как будто я не получаю от этого удовольствия, чувствую, что должна, я должна отвечать, когда кто-то на работе пишет мне по электронной почте, или я не знаю, должен ли я быть должен.

Тема 3: Последствия чрезмерного использования Интернета . Тема «Последствия чрезмерного использования Интернета» характеризовалась описанием участниками краткосрочных и долгосрочных последствий использования Интернета. Подтемы включали результаты физического и психического здоровья, психосоциальное функционирование и производительность труда.Хотя не все эффекты были негативными, участники чаще указывали на негативные последствия, особенно в отношении здоровья и работы.

Участники обсудили неблагоприятные последствия для здоровья в результате чрезмерного использования Интернета. Несколько участников сообщили об общих опасениях по поводу физического здоровья. Эти опасения включали лишение сна (например, «Я думаю о недосыпании. Я знаю, что даже когда я закончу работу, это где-то 12 или 1 час. Интернет» [«Нэнси», азиатка]), малоподвижный образ жизни (напр.ж., «Я планирую заниматься спортом, например, я буду сидеть там, продолжать читать всякую ерунду и типа «жаль, что я не успел потренироваться» [«Кевин», белый мужчина]), и плохая осанка ( например, «…у нашего поколения довольно плохая осанка из-за того, что много печатают и сидят» [«Майк», афроамериканец]). «Том», белый мужчина, указал на пересечение психического и физического здоровья, заявив: «Я злюсь на себя, чувствую разочарование, если однажды проведу много времени в Интернете вместо того, чтобы заниматься чем-то физическим или выходить на улицу.

Другие студенты сосредоточились главным образом на своем переживании психологических симптомов. Для некоторых участников гнев и разочарование были наиболее распространенными симптомами. «Хезер», афроамериканка, сообщила: «Первое, что нужно сделать сегодня, это зайти на Facebook или Twitter. Если я услышу какую-нибудь глупость, это будет раздражать меня до конца дня». Точно так же «Люси», азиатская женщина, отметила разницу в своей повседневной раздражительности:

Я думаю, что после долгого пребывания в Интернете я чувствую себя глупо, точно так же, как я чувствую, что потерял много времени впустую.Я думаю, что даже иногда я не общаюсь с людьми в течение длительного времени в течение дня, я стал более раздражительным.

Другие участники сообщили, что испытывают грусть и депрессию после использования Интернета. У некоторых эта грусть была вызвана сравнением их нынешнего образа жизни с тем, который их сверстники размещали в социальных сетях. «Эндрю», белый мужчина, уточнил, заявив:

Обычно большинство людей публикуют на самом деле лучшую часть своей жизни, поэтому в половине случаев вы идете туда и просто видите что-то вроде «О, мне так весело, и я на пляже, на вечеринке с горячими девушками». .А ты такой: «Я в своей комнате в общежитии, и я… я работаю в Макдональдсе». Сомневаюсь… их жизнь… намного лучше моей. Но когда я уже в депрессии, захожу в Интернет и вижу это, я такой: «Да, чувак, я отстой».

Использование учащимся Интернета и последующие отчеты о состоянии здоровья могут быть связаны с конкретными действиями в Интернете, которыми они занимаются, и с их моделями использования Интернета. Как отметила афроамериканка «Хезер»: «Если вы общительный человек, то это [социальные сети] дополняет его.Это как более быстрый выход… Но если это не так, то вместо этого вы просто смотрите». Цитаты, подобные этой, подчеркивают двойное или парадоксальное влияние Интернета на социальное функционирование. То есть Интернет может улучшить социальную жизнь студента; однако при чрезмерном использовании и способами, которые способствуют и усиливают социальную изоляцию, его использование может уменьшить количество и качество личных социальных взаимодействий. Некоторые участники жаловались, что их общение лицом к лицу было затруднено из-за того, что их сверстники пользовались Интернетом.«Нэнси», азиатка, так объяснила свои переживания:

У меня есть такая штука, особенно когда я с кем-то ем, они достают свой телефон и начинают проверять свой Facebook, Twitter или что-то в этом роде, я посмотрю на них и буду как — Серьезно, ты собираешься сделать это прямо сейчас передо мной?

«Ден», афроамериканец, отметил, что зависимость от Интернета для социального взаимодействия может привести к отсутствию навыков общения лицом к лицу: «Когда вы сидите за компьютером, вы тратите время на создание идеального сообщения… Но когда вы лицом к лицу, [человек] немного социально неуклюж, не совсем там.Кроме того, в цитате, отражающей чувства многих, «Лидия», афроамериканка, подчеркнула, что чрезмерное использование Интернета негативно повлияло на качество ее отношений, заявив: «Я бы пошла домой, вместо того, чтобы разговаривать с моей тетей и кузенами, я просто сидел на диване, играл с ноутбуком или телефоном. На самом деле не общайтесь ни с кем другим. Поэтому я ни с кем не разговариваю».

Другие участники, наоборот, отметили положительный социальный эффект от использования Интернета. Интернет может облегчить связь с семьей, друзьями и общественной поддержкой.«Фред», афроамериканец из второй фокус-группы, объяснил это так:

Мне казалось, что если ты в Твиттере, значит, ты на связи. Если вы находитесь в кампусе, все рядом. Но в то же время Twitter делает это ближе… Я чувствую, что вы позволяете людям узнать, что вы делаете, более публично, чтобы они могли тусоваться с вами, если вы хотите.

Интернет оказался особенно важным для участников отношений на расстоянии. «Анжела», афроамериканка, описала преимущества использования Интернета для связи с семьей, которая живет далеко, заявив: «Я думаю, что это полезно.Есть много членов семьи, с которыми я на самом деле не разговаривал… Так что я могу просто отправить короткое электронное письмо и сказать: «Привет, как дела», вместо того, чтобы звонить им».

Академическая продуктивность, заключительная подтема, описывает, как участники воспринимали влияние использования Интернета на общую школьную работу и производительность. Многие участники отметили негативное влияние чрезмерного использования Интернета на их общую успеваемость. «Лидия», афроамериканка, заявила: «Я чувствую, что если бы не использование Интернета, мои оценки могли бы быть в 10 раз лучше.Некоторые участники, такие как «Джесси», афроамериканка, связывали это с неспособностью сосредоточиться: «Моя способность долго концентрироваться на одном деле серьезно нарушена… Я не могу сосредоточиться даже на 2 минуты». Другие студенты отметили, что качество их работы страдало из-за прокрастинации в Интернете.

Добавить комментарий

Ваш адрес email не будет опубликован.