Ремонт шлейфов: Как спаять шлейф в случае его разрыва и восстановить поврежденные дорожки

Содержание

Восстановление подключения гибкого шлейфа ЖК-экрана

Сегодня расскажу про довольно интересный случай восстановления гибкого шлейфа экрана прибора. Шлейф имеет дорожки в виде токопроводящего напыления и очень тонкий. Рассмотрим всё на примере ремонта металлодетектора Bosch DMF 10 Zoom.

Прибор поступил с заявленной неисправностью – не работает ЖК-экран. При этом сам прибор функционирует нормально, звуковая и световая индикация работают. Устройство уже довольно возрастное (2007 год выпуска), но вполне функциональное и востребованное, так что ремонт целесообразен.

Перед разбором не забываем извлечь батарейку и все работы проводим при отсутствии питания, дабы случайным замыканием не повредить устройство окончательно.

Крепёжные шурупы прячутся под наклейками двух нижних ножек.

Снимаем переднюю крышку, а также пластиковый держатель дисплея.

Шлейф подключён к плате приклеиванием – не самый удобный в плане ремонта метод. Присмотревшись, можно заметить, что несколько первых дорожек слегка оторваны от платы и повреждены. Из-за этого на экране и отсутствует изображение – прижав оборванное место можно наблюдать на дисплее некоторые работающие сегменты.

Сложно сказать, что послужило причиной. Возможно, деградация клея от времени. Но я больше склоняюсь к механическому воздействию – либо неудачное падение, либо неаккуратное вмешательство извне.

Приклеить назад шлейф нереально, поэтому придумал другой способ – небольшой переходник для соединения.

Для начала очень аккуратно полностью отрываем шлейф от платы. После начинается самый долгий и тонкий процесс. Напылённые дорожки на шлейфе покрыты белым силиконом для защиты. Его-то и нужно бережно удалить, не повредив при этом дорожки. Делал это под микроскопом скальпелем, что заняло около 2 часов. Очищаем 1-2 мм по всей ширине шлейфа.

Фото под микроскопом. Выглядит не очень аккуратно, но не забываем, что всё очень мелкое. После этого ещё дополнительно покрыл очищенные места токопроводящим клеем. После высыхания проверяем отсутствие замыканий между дорожками. Если они есть, то аккуратно ликвидируем их, счищая клей скальпелем.

Далее нам необходимо найти кусок платы с контактными площадками, шаг которых соответствует шагу дорожек на шлейфе. Небольшой лайфхак: если нет специальной линейки для измерения шага контактов, можно взять кусочек какого-нибудь полупрозрачного материала (в моём случае это стикер-закладка) и, приклеив его на шлейф, наметить проходящие дорожки. А потом использовать данный шаблон для поиска необходимой платы. Шаг дорожек данного шлейфа идеально совпал с шагом контактов PCI Express.

Поэтому твёрдой рукой вытаскиваем дорогущую видеокарту из системника и… В общем, донорская видеокарта в очередной раз нам послужит. Выпиливаем из неё два кусочка, как на фото ниже. Не забываем оставить по краям место для крепежа. Детали полностью идентичные по размерам.

К контактам нам необходимо подпаять тонкие провода. Аккуратно залуживаем около 1 мм каждой дорожки. Чтобы это легко сделать, заклеиваем остальную часть дорожки каптоновым скотчем, а оставшееся место залуживаем.

И припаиваем к ним проводки. взял самый тонкий МГТФ-провод, длина каждого около 5 см. И так 24 раза.

Далее начинаем собирать бутерброд. Совмещаем очищенные места шлейфа с контактами на плате. Я дополнительно использовал кусок скотча для удержания шлейфа после совмещения.

Накладываем сверху места контакта силиконовую прокладку (взял со старого дисплея). Была в наличии только такая, но можно было и потоньше.

Сверху вторая платка и затягивается винтами.

По картинкам понять проще, чем по описанию. Кстати, внимательный читатель по фото выше может заметить, что что-то не так. Припаянные провода явно отличаются от описанных выше. Дело в том, что окончательно собрать прибор удалось только с третьей попытки.

В первый раз я взял китайские провода для перемычек, но по факту они оказались очень жёсткими, да ещё и недостаточной длины, поэтому пришлось от них отказаться и вернуться с своему любимому МГТФ. Хотя у китайских проводов был несомненный плюс – различие цветов, что помогало при монтаже, а с белым МГТФ пришлось вдвойне внимательней быть, чтобы не перепутать местами.

Во второй раз до меня дошло, что металлические болты рядом с катушкой сенсора металлодетектора как-то не совсем правильно, поэтому их заменил на пластиковый крепёж (фото не сделал, к сожалению). В принципе, в устройстве есть возможность перекалибровать его и оно успешно функционировало с металлическими болтами, но решил не рисковать – вдруг это скажется на чувствительности – и заменил на пластиковые.

Далее подпаиваем провода новосозданного переходника к площадкам на плате детектора.

И дальше – проверка. И весьма успешная. На автотесте все сегменты экрана работают.

Пластиковый держатель экрана пришлось также немного «доработать напильником», а именно удалить левый упор, место которого занял наш переходник.

Провода аккуратно уложились сбоку. Для надёжности место пайки к плате устройства дополнительно укрепил термоклеем.

При сборке дополнительно следим, чтобы эти провода не попали случайно между половинками корпуса. Время покажет степень надёжности данной конструкции.

Поломки шлейфа матрицы – замена или ремонт?

Шлейфы матрицы для ноутбука с перетертыми проводами или же отломанными контактами на любого мастера сервиса по ремонту компьютерной техники наводят тоску, навеянную рядом сложностей, связанных с предстоящими работами. Самая главная сложность, как утверждают специалисты, заключается в поиске соответствующей документации, в которой содержится информация по распиновке контактов шлейфа. Найти ее, действительно, очень сложно.

Вместе с тем, мастера отмечают, что случаев поломки именно шлейфов матрицы ноутбуков встречается не так уж и много. В большинстве своем из строя выходят видеокарты или же матрица техники. Причем многие говорят о том, что, если уж произошло так, что сломался все-таки шлейф, то лучше сразу произвести его полную замену, заказав или купив данный элемент в специальных магазинах.

Убедиться в исправности шлейфа можно, подсоединив подобный, но стопроцентно работающий элемент. Шлейфы можно найти в местах массовой скупки ноутбуков. Однако, найти подходящую комплектующую можно не всегда. Особенно сложно придется тем, чей ноутбук в свое время выпускался ограниченной серией. Непросто будет найти точно такой же шлейф от БУ техники.

Однако есть и второй способ, который под силу опытным  мастерам, разбирающимся в электрических схемах. Он требует от специалиста много времени, а также поиска документации на шлейф и матрицу. Один из мастеров, в частности, поделился опытом подобного поиска неисправностей шлейфа матрицы на форуме, отметив, что на такой ремонт у него ушло три дня. За это время он успел прочитать огромное число даташитов и насмотреться постов в технических форумах.

В общем, помните, что если у вас вдруг не работает или же рябит монитор, сразу списывать все проблемы на отошедшие контакты в шлейфе матрицы для ноутбука не стоит. Как не стоит самостоятельно разбирать технику и усугублять ситуацию своими «умениями». В ремонтных мастерских нередко  приходится наблюдать картину, когда очередной умелец приносит исправить искромсанный им самим матричный шлейф, причем, изначально в технике не функционировала видеокарта или же были проблемы с матрицей. Отнесите ноутбук в ремонтную  мастерскую, где специалист точно определит, в чем дело. И если вдруг выяснится, что причина в шлейфе, лучше сразу замените его на новый. Ведь то, что было отремонтировано однажды, в скором времени попросит ремонта снова.

Замена и ремонт шлейфа, процессора и материнской платы

Гарантия: от 1 месяца

Длительность (от): 1 час


Неисправности электронных книг однотипны и часто связаны с дефектами шлейфов, процессоров и материнской платы. Разбитый дисплей вне конкуренции, но речь не о нем. Внутренние поломки являются системными, и для их ремонта требуется специализированное диагностическое оборудование и профессионалы инструменты.

Неисправностей обычно проявляются в виде:

• полосы на экране, или отсутствия части изображения;

• замедление реагирования, зависания и регулярные перезагрузки;

• быстрый разряд батареи;

• полная неработоспособность;

• отсутствие связи проводной и беспроводной.

Все указанные симптомы могут указывать на дефект в материнской плате, процессоре электронной книги или шлейфе. Определить истинную причину неработоспособности может только специалист.

Ремонт

Если причиной дефекта является один из шлейфов, то он меняется. В крайнем случае, в редких моделях, замена шлейфа может быть невозможна, тогда он восстанавливается. Но это очень кропотливая работа.

Замена материнской платы практически сравнима по цене с заменой самого девайса, но во многих случаях, если ремонт производится в сервисном центре, плату можно восстановить. Если же диагностика показала, что требуется замена процессора, то альтернативы нет. Для замены чипа потребуется паяльная станция или специальный фен, сплав Розе, спиртовая смесь, флюс, дополнительные радиаторы. Процедура невозможна без специализированного оборудования в условиях мастерской.

Сервис

Если вы наблюдаете снижение работоспособности электронной книги или дефекты изображения на экране, обращайтесь в сервисный центр Remobi. Центр оборудован современными диагностическими приборами и средствами для ремонта электронной и фото техники. Стоимость ремонта сообщается после диагностики. Если необходимо, можно оформить срочный ремонт.

Ремонт шлейфа сотового телефона своими руками

Самое подробное описание: ремонт шлейфа сотового телефона своими руками от профессионального мастера для своих читателей с фотографиями и видео из всех уголков сети на одном ресурсе.

Скажу сразу: я отнюдь не претендую на звание «великого самоделкина», но, всё-таки, я очень хочу поделиться с вами одним «рецептом», который поможет вам починить расслоившийся (пленочный) шлейф в мобильном телефоне-«раскладушке», при том — своими (то есть — вашими) руками! Интересно? Тогда поехали!

Однажды приключилась со мной оказия: накрылся «медным тазом» мой мобильник «LG», типа — «раскладушка». Проблема заключалась в том, что при открытии экрана — экран был синего цвета! Отнеся проблемную мобилу в сервис, мне сразу сказали: полетел шлейф, который передает сигнал. Решение — заменить однозначно! При этом мне «зарядили» такую цену, что проще было купить новую «трубу»: замена такого шлейфа стоила немногим меньше, чем стоимость нового телефона. «А как насчет починить этот?» — спросил я. В ответ мастер одарил меня презрительным взглядом и ответил: «Пленочные шлейфы ремонту не подлежат. Не хотите менять — покупайте новый телефон!». Да, диагноз печальный. Но что-то подсказывало мне, что проблема решается.

Видео (кликните для воспроизведения).

Придя домой, я вскрыл мобилку, а затем полез в Интернет: куда ж ещё за советом обратиться?! Перелопатив сотню сайтов, дельного совета я так и не нашел. Что советовали «мастера-кустари»? О, советов много: начиная от рецептуры десятка токопроводящих клеев, и заканчивая банальной заменой шлейфа в мастерской. Но это — всё не то, поскольку я решил — таки-да!- самостоятельно решить проблему! И решил! Вот как это было.

Во-первых, необходимо выяснить причину прерывания сигнала. В случае с пленочным шлейфом — это его расслоение. Даже если расслоение произошло на незначительном участке шлейфа — сигнала всё равно не будет. Это запомнили. Идем дальше.

Теперь нам необходимо извлечь шлейф из мобильника-«раскладушки». Скажу сразу: эта процедура требует очень много терпения и внимания, поскольку контакты шлейфа расположены в двух частях мобилки: внизу (там, где клавиатура) и в верху — там, где экран и микрофон. Подробно описывать процесс не буду, поскольку вы сами всё поймете, когда будете разбирать телефон. (От автора: если кто-то не понимает, то тогда лучше не рискуйте и отнесите телефон в сервис). Итак, предположим, вы добрались до шлейфа и извлекли его.

Теперь внимательно осмотрите его на предмет расслоения. Обычно, расслоение происходит на углах шлейфа (углы на шлейфе закругленные). Почему происходит расслоение? Да по той простой причине, что вы постоянно раскрываете и закрываете вашу «раскладушку». А прочность шлейфа имеет свои ограничения.

Но идем дальше: как восстановить целостность шлейфа? Вы не поверите, но это очень просто! Вам понадобится клей и кусочек медной проволочки. Клей, который вам необходим, называется «Супер-клей «Секунда» 505. Универсальный секундный клей» (это — дословная надпись на коробке от клея, который я и использовал для восстановления шлейфа). В чем его плюс? Во-первых, он слегка тягучий, а во-вторых — он не так быстро сохнет, как его «собрат»-китаец, сохнущий в течение доли секунды. Ну, что такое медная проволочка и где её взять, я уверен, говорить не надо.

Теперь так: берем иголку и спирт. Макаем иглу в спирт, иглой поддеваем место расслоения — одну из отслоившихся ленточек с дорожками. Вставляем между слоем спичку: чтобы не напрягаться в следующий раз. Теперь отрезаем от медной проволочки кусочек, длиной около 1 см. Берем зубочистку, окунаем её в банку с клеем, намазываем дорожку (любую), убираем спичку и быстро вставляем кусочек проволочки. Пальцами сжимаем шлейф (только аккуратно!). Всё: теперь подключайте шлейф и проверяйте его работу. У меня всё работает без проблем! Теперь ваши вопросы.

  1. 1) Вопрос: разве клей не препятствует контакту? Ответ: тот, который я вам рекомендую — не препятствует.
  2. 2) Вопрос: зачем нужна проволочка? Ответ: она нужна для того, чтобы замыкать контакты на дорожках шлейфа.
  3. 3) Вопрос: не будет ли короткого замыкания после такой процедуры? Ответ: нет, не будет!

Вот и всё. Будьте предельно внимательны и удачи вам!

На примере сотового телефона Samsung U600 рассмотрим наиболее встречаемые поломки данных моделей телефонов. У большей части телефонов данной модели через некоторое время выявлялся следующий дефект: перетирался шлейф, связывающий две части слайдера. В результате чего изображение на экране пропадало или просто появлялась на экране рябь. Еще один дефект: проблемы с сенсорными кнопками.

После некоторого времени перестал включаться фотоаппарат и стал не возможен просмотр фотографий в большом размере. В таком состоянии ему пришлось прибывать года три, пока, наконец, до него не дошли мои руки.

Для ремонта телефона U600 мне понадобились:

  • набор отверток,
  • острый нож,
  • пинцет,
  • шлейф Samsung U600, соединяющий две части телефона.

Для того чтобы не растерять болтики можно использовать магнит. В моем случае я обошелся только покупкой шлейфа, хотя при более плохом раскладе пришлось бы покупать еще и шлейф с сенсорными кнопками, но его удалось вернуть к жизни.

Прежде чем приступать к ремонту сотового подзарядите батарейку. После того как вы подзарядили батарейку, снимаем заднюю крышку вынимаем батарейку.


Не стоит забывать еще про один важный момент при ремонте телефонов, о котором часто говорят мастера это статическое электричество. Говорят что из-за него возможен выход из строя не которых элементов телефона. И чтобы не покупать статический браслет мы вспомним курс физики и прежде, чем разбирать телефон лучше провести влажную уборку в помещении то есть помыть полы и протирать влажной тряпочкой стол на котором будет вестись ремонт. При этом на столе не должно оставаться видимых следов воды. Такая процедура должна через некоторое время проводиться в течении всего ремонта и о статическом электричестве вы можете не беспокоиться.


Берем дальше нож и аккуратно поддеваем крышку под которой скрывается болт. Мастер который ремонтировал этот телефон первый раз к сожалению повредил крышку.
И выкручиваем болт.

Дальше выкручиваем еще 4 болтика держащие корпус телефона. И взявшись за часть корпуса в районе фонарика снимаем ее.

Следующий шаг с торца корпуса снимаем еще одну крышку, так же поддевая ее ножиком.

И выкручиваем два болтика находящихся по краям и снимаем эту часть корпуса телефона.


Теперь выкручиваем шесть болтов, которые держат корпус с клавиатурой.

Отсоединяем шлейф идущий к клавиатуре и микрофону, поднимая зажим который его держит и с двух сторон пинцетом выводим его из разъема.


Теперь аккуратненько достаем плату и переворачиваем ее, где и можем увидеть злосчастный шлейф из-за которого дисплей телефона и не работал. Ножиком не спеша со стороны платы поддеваем шлейф за корпус с разъемами. Ни в коем случае не стоит снимать его поддев за сам шлейф, так как корпус с контактами может оторваться от шлейфа, а если шлейф был новый то он придет в негодность. Отсоединив шлейф вы сможете спокойно снять плату и часть корпуса на которой она была установлена протащив шлейф через отверстие.

Далее откручиваем на другой части корпуса телефона еще два болта и сдвигаем металлическую часть корпуса как указано на рисунке.

Теперь снимаем шлейф из разъема обозначенного цифрой 2.

На этом разборка телефона Samsung U600 закончена следующий шаг ремонт телефона.

Сборка телефона производится в обратной последовательности, с небольшими нюансами. Устанавливаем новый шлейф в разъем 2 и фиксируем его защелкой. Теперь берем часть корпуса телефона, на которой установлен раздвижной механизм и поставив его вертикально устанавливаем кнопку включения телефона на свое место. Держа эту часть корпуса в таком же положении, берем вторую часть просовываем шлейф в проем и совмещаем обе части корпуса телефона. Для того чтобы они сошлись нужно не много сдвинуть в сторону механизм слайдера. Когда обе части совместятся закручиваем два болтика.
Часть телефона с дисплеем собрана берем часть корпуса с клавиатурой и просовываем шлейф сквозь отверстие в этой части корпуса.
Устанавливаем плату на которой стоит симкарта и к ней подключаем наш шлейф от другой части телефона и шлейф от клавиатуры и динамика.
Закручиваем корпус шестью болтиками к раздвижному механизму.
Устанавливаем нижнюю часть корпуса телефона и закручиваем ее. После чего с торца устанавливаем декоративную заглушку.
Устанавливаем последнюю часть корпуса телефона на место и прикручиваем ее.
Устанавливаем симку батарейку и проверяем телефон. Если все работы выполнены правильно, то телефон будет работать без проблем.

«Делаю сам — расскажу как сделать вам!»

Не работает или плохо работает сенсор в телефоне или планшете? Одна из частых неисправностей современных сенсорных устройств — повреждение сенсорного экрана. Его ещё называют «тачскрином», просто «тачем» или «сенсором». Не стоит отчаиваться — его можно заменить самому. Стоит такая панель не дорого, намного дешевле, чем покупать новый телефон.

Сегодня в глобальной сети Интернет полно всяких вирусов и различных шпионских программ. Если Вы пользуетесь Интернетом, то для безопасности Вашего телефона лучше установить антивирус.

Антивирус — это специальная программа, которая позволяет защитить Ваш телефон, компьютер и т.п. от атак всевозможных вредоносных программ.

Как перепаять micro usb разъем на планшете, телефоне, нетбуке, ноутбуке своими руками?

Сейчас в устройствах можно часто встретить разъёмы usb (ю-эс-би, англ. Universal Serial Bus — «универсальная последовательная шина»). Из за случайного механического повреждения, например, во время нахождения устройства в режиме зарядки часто встречается такая неисправность — как обрыв micro usb разъема. О том, как перепаять micro usb разъем самостоятельно вы узнаете в статье ниже.

Видео (кликните для воспроизведения).

Печатные платы и подвижные элементы современной мобильной техники соединяются между собой благодаря плоским проводникам, также именуемым шлейфами. В процессе активного использования устройства один из таких кабелей нередко надламывается, и владелец аппарата начинает интересоваться, как восстановить шлейф на телефоне. Конечно, человек, далекий от техники, скорее предпочтет восстановить удаленные с карты памяти телефона файлы, чем станет выполнять ремонт девайса своими руками. Наша статья для тех, у кого есть определенные технические навыки, она расскажет о том, как самостоятельно произвести ремонт в данной ситуации.

Как можно восстановить шлейф на телефоне?

Современные мобильные устройства быстро выходят из моды, и на смену им постоянно приходят другие. Однако не каждый пользователь готов выложить денежные средства не только на приобретение усовершенствованного смартфона, но и на покупку и установку нового шлейфа, вышедшего из строя. Если мы разберём мобильное устройство, то увидим, что контакты приклеены прямо к дисплею, и в данной ситуации мы вряд ли сможем что-то сделать. С противоположного конца шлейфы присоединены к плате в определённой последовательности.

Для поиска неисправного проводника используют прибор под названием омметр. При этом аккуратно отгибают соединительные элементы в противоположные стороны, чтобы выявить «мерцающий» контакт.

Поговорим о том, как восстановить шлейф на телефоне. Для ремонта нам понадобится набор материалов и специальных инструментов, включая плоскую отвёртку, увеличительную лупу, иглу, спирт, наждачную бумагу, паяльник, термоплёнку (толстый полиэтилен), липкую ленту и многожильный кабель МГТФ.

Но перед тем как приступить к ремонту, следует подумать, достаточно ли наших знаний-умений для этой затеи. Все-таки это не сравнить с элементарным удалением переписки в скайпе на телефоне, возможно, стоило бы обратиться в сервис.

Инструкция по восстановлению шлейфа телефона

Снимаем заднюю крышку корпуса устройства и извлекаем батарею. После этого выкручиваем винты крепления при помощи отвёртки. Снимаем основную плату и накладку под экраном, изготовленную из пластмассы. Она крепится на 2-стороннем скотче.

Теперь можно поискать обрыв на конкретной дорожке. Снимаем изоляцию при помощи иглы, облегчая себе просмотр увеличительным стеклом. Иглу лучше иногда подтачивать.

Наматываем на жало нашего паяльника отрезок медной проволоки. Лучше всего, если мы используем устройство низкой мощности (до 25 ватт). Опаиваем зачищенные участки проводника, устраняя остатки того, что было изоляцией. Зачищенный край оборванного шлейфа (около 1,2 миллиметра) подготавливаем к тому, чтобы припаять к основной плате. Если повреждены несколько проводников, повторяем вышеуказанное действие для каждого из них. Теперь припаиваем края к плате и проверяем на предмет наличия промежутков между дорожками.

Берём термоплёнку и оборачиваем её у припаянных краёв шлейфа в 1 слой. Прогреваем до того момента, когда она начнёт плавиться и приклеится к ленте. При этом может быть задействован обычный утюг. Главное – пользоваться им аккуратно и плавно, не допуская сильного нажима. При необходимости прогреваем шлейф и с обратной стороны.

Если дорожка обломилась не у края, а в центре, лучше всего продублировать её кусочками монтажного провода. Теперь можно приступить к сборке мобильного устройства.

Добавим, что если шлейф небольшого размера, его можно изготовить и своими силами. Для этого укладываем и крепим проводники на полоске тканевого медицинского пластыря.

Доброго времени суток, дорогие пикабушники! В данном посту будет рассказан один из способов как восстановить порванный шлейф на планшете/телефоне.

Потихоньку реставрирую планшет нашей любимой пикабушницы @Gondurasyanka , потом отдельным постом выложу. Сейчас просто расскажу как починить шлейф. В моем случае, шлейф камеры.

Вот такую беду я увидел, когда разобрал планшет.

Огорчало то, что шлейф двухсторонний, гемору больше, чем с односторонним. Если бы был односторонний, то просто “соплю” бросил на дорожку и делов-то. Тут повозиться немного пришлось, нельзя было паять методом “сопля”. “Сопля” попадет и на нижний слой, тем самым замкнет дорожки на верхнем и нижнем слое. Без микроскопа тут ловить нечего.

Знакомы ли вы с принципом соединения всех подвижных элементов с печатной платой во всех современных мобильных технологиях? Соединение этих элементов достигается при помощи шлейфов. В ходе постоянной эксплуатации данный компонент может выйти из строя. Как починить шлейф на телефоне? Пользователи без опыта сразу же впадают в панику и ударяются в поиски ближайшего сервисного центра. Но в мастерской услуги стоят довольно-таки немалых денег, а кто любит непредвиденные затраты? Данная статья поможет тем пользователям, которые имеют базовые знания в работе с современной техникой. Сегодня мы попробуем отремонтировать шлейф собственными усилиями.

Современные модели мобильных телефонов очень быстро теряют былую актуальность, потому что им на смену приходят новые версии устройств. Не каждый пользователь готов отдать большую сумму денег, для того чтобы обзавестись новеньким мощным смартфоном. Компоненты на такие девайсы стоят не сильно дорого, но их установка — это довольно затратное мероприятие.

Можно ли провести ремонт шлейфа своими руками? Если вы разберете свой гаджет, то увидите, что контактные площадки крепятся прямо на дисплей. С обратной стороны корпуса эти детали присоединяются к печатной плате в определенной последовательности.

Важно! Для того чтобы определить неисправность, нужно обзавестись новеньким мультиметром, в который будет встроен омметр для измерения сопротивления. В тех же сервисных центрах соединительные компоненты отгибаются в противоположные стороны для выявления проблемного контакта.

Если же во время диагностики выявились и другие проблемы, советуем их одновременно устранить. Возможно, в этом случае вам пригодятся другие наши публикации:

Чтобы провести ремонт в домашних условиях, нужно знатно подготовиться и найти специальные материалы и инструменты, такие как:

  1. Плоская отвертка.
  2. Увеличительное стекло.
  3. Иголка.
  4. Спиртовой раствор.
  5. Наждачка.
  6. Паяльная станция.
  7. Толстый слой полиэтилена.
  8. Клейкая лента и многожильный кабель МГТФ.

Важно! Прежде чем приступать к восстановительным работам, подумайте несколько раз. Все манипуляции не представляют особой сложности, если вы когда-либо занимались чем-нибудь подобным. Если стопроцентной уверенности в успехе нет, то рекомендуем все-таки отыскать сервисный центр, где квалифицированные работники возьмут дело в свои руки.

Для того чтобы провести ремонт шлейфа телефона, вам необходимо выполнить следующие действия:

  • Извлеките заднюю крышку корпуса вашего устройства и извлеките аккумуляторную батарею.
  • Теперь необходимо выкрутить крепящие винты, используя плоскую отвертку.
  • Снимите главную печатную плату и пластмассовую накладку, что находится под экраном. Крепится последний компонент на двустороннем скотче.
  • Далее нужно заняться поиском разрыва на какой-либо из дорожек. Для этого стоит избавиться от изоляции при помощи иголки.

Важно! Для облегчения процедуры используйте увеличительное стекло.

  • Берем в руки паяльник и наматываем на его жало кусочек медной проволоки. Лучше всего подойдет компонент с низкими параметрами мощности (где-то 20-25 Ватт). Отпаиваем остатки изоляции провода.
  • Край, который только что был зачищен, нужно подготовить к соединению с платой.

Важно! Если по какой-то причине были повреждены сразу несколько проводников, то повторяем последнюю манипуляцию для каждого из них.

  • Если с предыдущим пунктом закончили, то переходим к самой пайке. Припаиваем края на печатную плату и внимательно осматриваем всю схему на предмет наличия разрывов между дорожками.
  • Возьмите в руки термопленку или слой полиэтилена, оберните ей края припаянного шлейфа хотя бы в один слой. Прогревайте все это дело до того момента, пока не подплавите пленку, тем самым приклеив ее к ленте. Для этого действия прекрасно подходит утюг, но нужно брать во внимание, что вся процедура должна проходить с особой осторожностью.
  • Бывает так, что дорожка надламывается не у краев, а в самом центре. Для устранения такой неполадки лучше всего продублировать эту дорожку при помощи кусочков монтажного проводника.
  • Теперь собираем мобильное устройство в обратном порядке и проверяем его на работоспособность.

Важно! Также вам следует знать, что шлейф можно изготовить самостоятельно. Для этого нужно уложить проводники на пласт обычного медицинского пластыря.

Как отремонтировать шлейф телефона другим способом? Все очень просто.

Восстановительные работы можно провести и следующим образом:

  • Сперва измельчаем небольшое количество канифоли до состояния порошка и растворяем в спиртовом растворе. Для создания раствора используйте пропорциональное соотношение один к шести.
  • Теперь берем в руки старый добрый клей “Момент” и клеем поврежденный участок на изолированную пластину. Затем нужно положить это соединение под самый обычный технический микроскоп, которым все пользовались на уроках биологии в школе.
  • Приступаем к снятию изоляции. В качестве инструмента можно использовать скальпель или маленький нож. Убираем где-то 1,5 мм провода в месте обрыва. Дальше нужно нанести немного того раствора, который был в первом пункте, на участок ленты. Используйте кисточку для нанесения смеси. После нанесения прикоснитесь жалом паяльника к данному участку шлейфа.
  • Снимите лак с помощью скальпеля и тщательно смажьте этот отрезок раствором канифоли и спирта. Залудите проводник на 25 мм от его кромки и осторожно припаяйте его к самой крайней дорожке по отношению к крайнему шлейфу.

Важно! Для удобства лучше приподнять провод в середине над теми частями, что повреждены.

  • Загибаем участок провода, который соединяем две стороны нерабочей дорожки и откусываем кусачками лишние части, которые образовались в ходе работе. Остается припаять шлейф к плате.
  • Если имеется необходимость в “наращивании” шлейфа, то воспользуйтесь другим отрезком шлейфа с соответствующими геометрическими размерами. Разрежьте компонент перпендикулярно поврежденному участку.
  • Зачищаем, соединяем и паяем обе половинки. Изолируем участки провода, которые оголены и собираем мобильник в обратной последовательности.

к содержанию ↑

Ремонт шлейфа планшета своими руками — это очень простое и выгодное занятие. Своими силами вы можете сэкономить свои деньги и отложить их на будущее.

Рассмотрим одну из основных причин выхода из строя мобильника: «попадание на плату различных жидкостей» не включается, белый экран или не работают некоторые кнопки. Конечно перед вскрытием корпуса нужно знать причину поломки. Если одна из выше написанных читаем дальше.

Вскрываем, проводим визуальный осмотр на наличие коррозии, грязи и других ненужных веществ.

Первым делом снимаем все пластиковые детали, вообщем всё, что можно снять – отцепляется. Не забудьте про пленку с клавиатурными кнопками типа мембран, её тоже отклеиваем (это на других моделях, на нашем клавиатурная плата отсоединяется).

Берём очищающую жидкость (такие как спирт, бензин «Колоша», одеколон) я использую «Изопрапанол», он не имеет неприятного запаха, как «Колоша».

Берём зубную щетку, кому не жалко – новую, макаем в спирт, и чистим плату, пока не будет выглядеть как новая – особенно контакты для дисплея, разъем USB. Сильно не нажимать, можно снести некоторые компоненты.

Почистили, теперь берём флюс, берём кисточку, мажем флюсом возле микросхем (побольше), ставим фен на 325 градусов и прогреваем по кругу и в середину все микросхемы, расстояние от выхода наконечника (сопло) фена до поверхности микросхемы – 1,5 см. Наконечник лучше и экономние взять среднего диаметра.

Греем до такой степени, чтоб у расположенных по периметру компонентов расплавилось олово (регулируйте температуру до 330 градусов). Очень и очень аккуратненько иголкой покачайте микросхему, чтоб она чуть-чуть пошевелилась. Важно не сильно шатать, иначе съедет с контактов, и так со всеми не приклеенными (без компаунда) микросхемами. Прогреваем также фильтры, чтоб очистить от флюса можно использовать ультразвуковую ванну, но мы сделаем по другому.

Заливаем под все микросхемы без компаунда спирт, немного подержите, чтоб спирт успел собрать всю грязь. Теперь берём фен от паяльной станции и продуваем под микросхемами. Выдувая таким образом спирт из-под микросхем, нам он там ненужен. Температура фена должна стоять для прогрева, а не для пайки, это в пределах от 260 до 290 градусов, смотря какая станция.

Продули, идём дальше. Теперь даём остынуть и собираем. Если после сборки поломка исправлена то “Ура всё готово”. Если всё же белый экран и нетокорые кнопки не работают – нужно заменить фильтры или поставить перемычки, но это другая история. Самые главные детали, которые могут выйти из строя после воды или после падения (удара) – это фильтры (так называемые стекляхи), они выглядят вот так.

С ними нужно проделать тоже самое, что и с остальными микросхемами, только более тщательно пропаивать эти места. Прогреть, пошевелить, про флюс (не забываем наносить) с ним компоненты не слезут с контактов. Теперь вроде бы всё. То, что мы проделали, относится только к поломке по причине попадания влаги во внутрь телефона. Другие поломки, типа “не заряжается” или “сеть не ловит” – так не исправить, нужна будет замена компонентов. Об этом в дальнейших публикациях. С уважением, ОРА.

Вот это как раз и надолго,если всё правильно сделать и не перегреть шлейф.Для этого лучше потренироватся на дохлых телефонах.

Не спорю, просто я знаю случаи когда со временем шлейф опять отклеивается. А так он хорошо фиксируется. (имхо, это моя теория)
Я клеил на gigaset 900, все работает кроме set, и трех секторов на одной цифре.
отодрать можно, если захотеть- клей паяльником плавится, но мороки потом много от него

Скажите, а что это за иголочки такие ? читал, но никак не пойму в чем суть.

Эти многожильные соединения берут на себя роль подвижного сочленения электрических плат, отдельных моделей и других узлов схемы.

К наиболее распространенным типам подключения шлейфов можно отнести:

  1. Пайка (один из самых надежных способов, но он требует определенного технологического процесса и оборудования, перегрев элементов схемы при пайке может вывести их из строя).
  2. Различные механические сочленения (зажимы, вставки и т.п., выполнить такое соединение очень просто, не требуется дополнительного оборудования или навыков, к недостаткам можно отнести низкую надежность – шлейф может не до конца прижаться, контакты со временем окисляются и т.п.).
  3. Наклейка на проводящий ток клей/клейкую ленту (на этом способе подключения шлейфов и остановимся подробнее).

Изначально адгезионные технологии применялись для монтажа чипа на подложку при помощи специальной токопроводящей пасты. В этом случае не требовалась пайка (то есть нагрев), паста застывала, обеспечивая необходимый теплоотвод и проведение электричества.

Позже технологию взяли на вооружение для подключения различного рода дисплеев и других узлов цифровой техники.

Современные токопроводящие клеи могут быть:

  • Изотропные. Отличаются тем, что внутри токопроводящего материала нет никаких ограничений на направление распространения тока, среда однородная. Это могут быть ICA (изотропные клеи) или ICP (изотропные пасты).
  • Анизотропные. Внутри токопроводящего материала ток распространяется только в определенном направлении. В эту группу можно отнести ACA (анизотропные токопроводящие клеи) и ACF (анизотропные токопроводящие пленки).

Последние получили наибольшее распространение в бытовой технике. Так, при помощи ACF можно приклеить шлейф к матрице ЖК телевизора. Ток будет проходить между соединяемыми контактами строго перпендикулярно их поверхности внутри анизотропного скотча.

Использование любых клеящих смесей связано с определенными ограничениями. Различные ACF-пленки (скотчи) рассчитаны на соединение определенных видов материалов, требуют соблюдения температурных и влажностных режимов, отсутствия пыли и других мелких частиц, препятствующих адгезии, а также определенных условий прижатия склеиваемых поверхностей (минимальное усилие, нагрев и т.п.).

Немаловажным показателем использования ACF является минимальный требуемый зазор между контактами (у каждого типа пленки он свой).

ВИДЕО ОПИСАНИЕ

Большинство современных плат для цифровой техники использует механический способ подключения шлейфов, однако, в отдельных случаях могут использоваться анизотропные токопроводящие пленки (скотч) или клеи.

Чтобы приклеить гибкий шлейф к плате в случае с ACF необходимо:

  1. Очистить остатки предыдущего соединения/скотча с помощью изопропилового спирта.
  2. Взять анизотропную клеящую пленку (подойдет, например, 3M Z-Axis 9703, перед применением обязательно следует убедиться, что расстояние между контактами не превышает 0,4 мм, так как при меньшем размере можно получить короткое замыкание).
  3. Снять первый защитный слой и наклеить пленку на плату.
  4. Снять второй защитный слой с ACF-пленки.
  5. Правильно сопоставить контакты шлейфа и контакты на плате, приложить шлейф и равномерно придавить к поверхности платы с достаточным усилием.

При проведении работ обязательно следует учесть, что в воздухе не должно быть пыли и мелких частиц (если наклейка производится в бытовых условиях, работу можно проводить в ванной комнате).

Технология монтажа шлейфов с помощью токопроводящей клейкой ленты идентична процессу соединения шлейфа и платы.

Отличия могут быть лишь в поддерживаемых материалах (например, скотч Axis 9703 не рекомендуется для монтажа на стеклянные поверхности, подойдут только пленки 5352R и 5552R от того же производителя) и минимальном рекомендуемом зазоре между контактами (так, пленка 3M Z-Axis 5552R может применяться при расстоянии между контактами менее 100 микрон).

Некоторые токопроводящие пленки или клеи могут требовать нагрева или большого усилия, прилагаемого к склеиваемым поверхностям при монтаже.

Перед покупкой в обязательном порядке следует ознакомиться со спецификацией пленки/клея. Уточнить порядок применения.

Часто случается, что в процессе разборки дисплеев или другой сложной техники при отклеивании шлейфа прикладывается чрезмерное усилие, и он рвется.

Приобретение такого простого с виду элемента может стать практически невыполнимой задачей, так как аналогичных проводников в продаже не найти, как и доноров (сломанной техники, с которой можно снять запчасти).

В этом случае ACF пленка или клей спасет ситуацию, вне зависимости от типа шлейфа.

Процедура так же проста, как и в случае с подключением шлейфа к плате или монитору.

  1. Поврежденный участок шлейфа вырезается. Для этого проводник полностью перерезается под прямым углом в двух местах по краям от порыва (поврежденного участка).
  2. При необходимости на стыкуемом участке токоведущие части оголяются (если в середине шлейфа проводники заизолированы) и обрабатываются спиртом.
  3. Снимается первый слой защитной пленки с ACF, и скотч наносится на конец одного из обрезков шлейфа.
  4. Снимается второй защитный слой и прикладывается второй обрезок шлейфа.
  5. В зависимости от требований технологии монтажа пленки может потребоваться нагрев или достаточное усилие сжатия места соединения (здесь важно учесть, что некоторым типам шлейфов нагрев противопоказан, значит, соединяющую пленку следует выбирать с монтажом без нагрева).

ВИДЕО ИНСТРУКЦИЯ


Недостаток такого метода восстановления шлейфа – уменьшение его длины.

Для начала настоятельно рекомендуется ознакомиться хотя бы с основами радиоэлектроники. Дело в том, что ремонт мобильных телефонов тесно связан с теоретическими познаниями в этой сфере. Например, если необходимо заменить резистор (это пассивный токоограничивающий радиоэлектронный компонент) то обязательно нужно знать его маркировку, сопротивление, рассеиваемую мощность, температурный коэффициент и т.д. Другими совами, не очень целесообразно заниматься ремонтом мобильников не зная закона Ома. Книг и пособий на тему радиоэлектроники, а также тематический сайтов в сети Интернет огромное количество. Но и этого мало. Мобильные телефоны – это цифровые устройства, а не аналоговые. Следовательно, все детали и компоненты, применяемые для производства последних, имеют между собой различия. К примеру, для аналоговых устройств, в основном применяется технология навесного монтажа, а для цифровых – поверхностного монтажа. Последняя технология называется SMT (surface mount technology). Она так и переводиться как «технология поверхностного монтажа». А компоненты, используемые при этой технологии, называются SMD (surface mount device).

Также, в цифровой электронике отсутствует аналоговый сигнал, т.к. он собственно, цифровой. Следовательно, все цифровые устройства имеют свои типы и уровни программирования. Это всего лишь несколько отличий между аналоговой и цифровой техникой. Но и этого достаточно, чтобы отпугнуть новичка. Но здесь не нужно отчаиваться. Всё намного легче, чем кажется. Множество той устрашающей информации при ремонте мобильных устройств не понадобиться. Но если же Вы планируете всерьёз заняться этим делом, то настоятельно рекомендуется заняться изучением аналоговой и цифровой радиоэлектроники.

Вот мы и подошли к основной цели этой статьи. Итак, сейчас Вам будет подробно описаны процедуры технического ремонта мобильных телефонов и виды ремонтных устройств.

Для того чтобы отремонтировать сотовый телефон, в том числе произвести ремонт Nokia, Samsung, Sony-Ericsson, LG, Motorola, первое что необходимо, это определение причины выхода из строя мобильного устройства и выявление компонента, узла, модуля или детали вышедшей из строя. Для этого как раз необходимы те знания, которые описаны выше. Обычно поломка мобильного телефона обуславливается неправильной эксплуатацией или потерей работоспособности внешних устройств. К примеру, в первом случае, телефон упал в воду по неосторожности. Для его восстановления необходима полная разборка и тщательная просушка. После этого нужно щёткой с мягкой щетиной прочистить печатную плату телефона специальным чистящим средством или 96-процентным спиртовым раствором. Во втором случае, вышел из строя ЖК-дисплей, динамик, микрофон, клавиатура и т.д. Как правило, в большинстве случаев, такие детали не подлежат ремонту и требуют замены. Но если же произошло повреждение поверхностных (припаянных) деталей на печатной плате, то здесь требуется профессиональный подход и опыт. К тому же, для такого вида ремонта Вам потребуется схема узлов, модулей и компонентов печатной платы мобильного телефона.

Для того, чтобы начать процедуру ремонта, телефон необходимо разобрать.

Чтобы вскрыть мобильный телефон, не принеся ему косметического урона, нужно обзавестись специальными инструментами для их вскрытия. Они позволяют аккуратно и максимально эффективно открыть корпус телефона, не принося дефектов. Как правило, эти инструменты продаются наборами, каждый предмет которого, отвечает за свою специфику вскрытия. Такие наборы не трудно найти в специализированных магазинах. Кроме того, они бывают различных видов. Разницу что составляет функциональность и цена.

Ещё Вам потребуется специализированный набор отвёрток для мобильных телефонов. На этом не нужно экономить. Чем больше будет видовое количество насадок, тем больше у Вас будет шансов раскрутить винтики, не сорвав грани.

Далее, чтобы провести диагностику телефона на предмет его неисправности, Вам потребуется хороший цифровой мультиметр. С помощью него можно провести измерения переменного и постоянного напряжения и силы тока, сопротивления, ёмкости конденсаторов, коэффициент транзисторов, состояние диодов, прозвонку цепей, участков цепей или узлов, температуру. При умелом использование и знании некоторых физических законов им можно находить неисправности в цепи. Ассортимент мультиметров колоссален. Разница, как правило, заключается в функциональности и цене.

Также нам потребуется лабораторный источник питания или блок питания. С помощью него можно будет устанавливать заданное напряжение и силу тока. Он будет очень часто требоваться Вам при проведении ремонтных работ, т.к. подставлять аккумуляторную батарейку для проверки, раз за разом, будет неудобно. Современные источники питания оснащены функцией стабилизации и защиты по току, а также большим количеством всевозможных зажимов и щупов для различных случаев.

Оборудование и приспособления для пайки. Для проведения паяльных работ Вам потребуется паяльная станция. Их разнообразие бесконечно большое, а выбор обуславливается ценой и функциональным диапазоном. Есть комбинированные паяльные станции, сочетающие в себе, как и нагревательный паяльник с регулировкой температуры, так и термовоздушный фен, который также имеет функцию регулировки температуры и потока воздуха.

Термовоздушный фен, как правило, необходим для монтажа и демонтажа SMD-компонентов, а также интегральных микросхем, выполненных в корпусе типа BGA.

Также при проведении паяльных работ Вам потребуется устройство для нижнего подогрева печатных плат. Дело в том, что при монтаже или демонтаже, к примеру, интегральных микросхем (чипов), есть риск их перенагрева и вывода из строя. При использовании подогревающего устройства, на которое кладётся и фиксируется печатная плата мобильного телефона, происходит рациональный нагрев платы. И уже при нагретой плате можно приступать к монтажу или демонтаже компонентов, не опасаясь за их поломку, т.к. эта процедура происходит за несколько секунд.

Для паяльных работ также не помешает антистатический термо-пинцет. С помощью него очень удобно производить демонтаж некоторых компонентов.

Поскольку Вы будете сталкиваться с проведением паяльных работ по монтажу/демонтажу интегральных микросхем, то Вам потребуется вакуумный манипулятор. Это устройство бывает ручным и автоматическим. Оно предназначено для того, чтобы максимально точно, эффективно и удобно было размещать чипы контактными ножками на поверхности печатной платы мобильного устройства. Пинцетом это делать неудобно, тем более, есть большая доля вероятности при нерассчитанном нажиме «убить» микросхему. С вакуумным манипулятором этого никогда не произойдёт.

Также в работе Вам понадобиться оловоотсос. С помощью него Вы без труда сможете произвести отпайку посредством удаления расплавленного припоя.

Оптика. Детали и компоненты мобильных телефонов исчисляются в микрометрах и нанометрах. Понятно, что работать без специальных увеличительных средств очень проблематично и вредно для зрения. В этих случаях настоятельно рекомендуется обзавестись техническим микроскопом на 40 диоптрий (не путать с биологическим). Также Вам понадобиться настольная лупа с подсветкой. С микроскопом удобно работать не во всех случаях, а настольной лупой пользоваться удобно практически всегда, когда не требуется сверхвысокого увеличения. Не помешает также монтажные увеличительные очки или налобные бинокулярные очки.

Для проведения отмывки, очистки всевозможных компонентов и печатных плат от загрязнений, масел, жиров, припоя, налёта и канифоли, Вам потребуется ультразвуковая ванна. Она очень эффективно и безопасно производит очистку ультразвуком.

Прочий инструмент. Из прочего монтажного инструмента и принадлежностей Вам понадобиться монтажный фиксирующий столик, с помощью которого легко и надёжно закрепить печатную плату для проведения ремонтных работ. Обязательно нужно иметь при себе различные пинцеты, монтажные шила, круглогубцы, плоскогубцы, длинногубцы, кусачки. Этот список можно пополнить паяльной пастой, флюсом, припоем, канифолью, очистителями, жидкостью для ультразвуковых ванн и прочими расходными материалами.

Где брать детали и компоненты для ремонта? Конечно, их можно купить в специализированных магазинах, но лучше всего скупать поломанные телефоны. Так как в некоторых случаях, некоторые детали найти будет очень проблематично, а купить, например, сломанный телефон, в котором имеется нужная деталь, не составит труда, к тому же, по очень низкой цене.

Ну вот мы с Вами и ознакомились с тем минимумом, которым должен обладать инженер по ремонту мобильных устройств. Конечно, знания и опыт придут со временем, по мере наработки теоретических и практических навыков. Читайте книги по радиоэлектронике, по возможности, запишитесь на специальные курсы обучения ремонту мобильных телефонов, общайтесь с людьми, имеющими опыт в этой сфере, посещайте специализированные форумы по конкретным темы, там всегда люди готовы помочь.

В общем, огромных успехов Вам в деятельности по ремонту мобильных телефонов!

Еще больше информации для обучения самостоятельному ремонту мобильных телефонов ТУТ.

Автор статьи: Антон Кислицын

Я Антон, имею большой стаж домашнего мастера и фрезеровщика. По специальности электрик. Являюсь профессионалом с многолетним стажем в области ремонта. Немного увлекаюсь сваркой. Данный блог был создан с целью структурирования информации по различным вопросам возникающим в процессе ремонта. Перед применением описанного, обязательно проконсультируйтесь с мастером. Сайт не несет ответственности за прямой или косвенный ущерб.

✔ Обо мне ✉ Обратная связь Оцените статью: Оценка 4.3 проголосовавших: 7

Ремонт и замена шлейфа телефона – за 20 минут в Челябинске! Сервисный центр IT-TON

Качественный ремонт и замена шлейфа телефона – только в IT-TON!

Шлейф – это плоский кабель, который выполняет функцию соединения функциональных узлов между собой. Его поломка влияет на стабильность работы устройства. IT-TON – это один из самых популярных сервисных центров, который начиная с 2012 года осуществляет ремонт шлейфов смартфонов всех брендов и моделей. Ремонт шлейфа телефона в Челябинске – непростой процесс, благодаря которому с легкостью устраняются неисправность устройства. Данная процедура должна проводится под пристальным вниманием специалистов и с помощью инновационного оборудования. Если Вам необходимо выполнить замену шлейфа телефона, срочно обращайтесь в наш сервисный центр, который сделает все возможное для того, чтобы вернуть Ваш гаджет в рабочее состояние.

 

Признаки неисправности девайса

Нестабильная работа любого модуля в телефоне возникает из-за поломки самого модуля либо из-за соединяющего шлейфа. Во втором случае восстановление функциональности займет меньше времени. Признаки поломки шлейфа:

  • Появления дефектов на экране устройства, искажение картинки.
  • Нарушение функциональности динамиков, тихий звук и хрип.
  • Неисправность клавиатуры или сенсора.

 

Диагностика телефона

Если произошло так, что телефон сломался, не включается, и Вы не можете выяснить причину поломки то, скорее всего, вышел из строя шлейф. Наш сервисный центр выполнит профессиональную диагностику мобильного девайса, и точно выявит причину поломки. К счастью, диагностика в мастерской IT-TON проводится абсолютно бесплатно, что поможет Вам значительно сэкономить на ремонте или замене шлейфа смартфона. Не определились с сервисным центром? Смело обращайтесь к нам за высококлассной помощью!

 

Преимущества сервисного центра IT-TON:

  • Индивидуальный подход к каждому клиенту и его проблеме.
  • Предоставление бесплатной диагностики устройств.
  • Выполнение поставленных задач в течение 2-3-х дней!
  • Использование исключительно современного оборудования.
  • Предоставление гарантий на выполненную работу. Наш сервисный центр предоставляет гарантии на срок от 1 до 3 месяцев.
  • Мы предоставляем 100% качество выполненных работ.
  • Наша команда – это только профессионалы!
  • Только высокопробные комплектующие с гарантией.
  • Предоставление консультаций.
  • Доступные цены, благодаря которым Вы значительно сэкономите на ремонте гаджета.

IT-TON – Ваш лучший помощник в профессиональном выполнении ремонтных работ!

Оборудование: набор профессиональных отверток, пинцет, пластиковая лопатка.

Комплектующие: оригинальные запчасти, а также их качественные аналоги.

Сроки: от 30 мин.

Гарантия: 3 месяцев.

 

Цены на замену шлейфа телефона представлены в таблице:

Вид предоставляемых работЦена
ДиагностикаБесплатно*
Замена межплатного шлейфа900 руб
Замена шлейфа синхронизации и зарядки900 руб
Замена шлейфа аудио разъема900 руб
Замена шлейфа кнопки включения / Power900 руб
Замена шлейфа Качельки громкости900 руб
Замена шлейфа кнопки домой / Home900 руб

*Указаны ориентировочные цены, чтобы узнать точную стоимость ремонта, выберите Вашу модель телефона в верхнем меню сайта

Замена шлейфа ноутбука за 20 минут в сервисном центре Fortis-service

Шлейфами называют гибкие проводящие элементы, которые соединяют материнскую плату с другими комплектующими — например, матрицей, жестким диском, клавиатурой, CD/DVD приводом. Выходят из строя они достаточно редко, чаще всего по причине механических повреждений. Основная сложность — определить, что требуется замена шлейфа ноутбука. Дело в том, что признаки неполадок практически неотличимы для непрофессионала от поломок видеокарты, дисковода и других комплектующих. Соответственно, только после тщательной диагностики удается определить истинную причину неисправности.

Основные причины замены шлейфа

Если говорить о ситуациях, которые приводят к необходимости замены шлейфа ноутбука, то основных — три. Самая распространенная — это падение лэптопа. Второй является слишком частое или неаккуратное открывание/закрывание ноутбука, в результате чего истирается шлейф матрицы. Наконец, проблемы могли возникнуть при сборке или разборке устройства. Если этим занимался неопытный специалист, то он мог пережать определенный участок шлейфа или неправильно подсоединить его к комплектующей.

Определить, что в ноутбуке проблемы с одним из шлейфов, можно по следующим признакам:

1. Изображение на дисплее периодически искажается или совсем пропадает, причем качество картинки меняется при поднимании и опускании крышки.
2. Дисковод работает со сбоями, причем ноутбук не всегда его определяет.
3. Лэптоп самопроизвольно выключается во время работы или отказывается включаться.
Ноутбук не видит жесткий диск

Чтобы проверить работу шлейфов, специалисты обычно заменяют их на гарантированно исправные. Однако поскольку для диагностики требуется полностью разобрать ноутбук, не рекомендуется проводить подобное тестирование самостоятельно. При обнаружении неисправности обычно производится замена шлейфа ноутбука, поскольку этот элемент стоит относительно дешево, поэтому ремонт производить просто нерентабельно.

Замена шлейфа матрицы

Шлейф матрицы ноутбука достаточно часто выходит из строя. Основные причины: перетирание шлейфа в месте крепления матрицы (около петель ноутбука). Основные симптомы: нет изображения на экране, полосы на экране ноутбука, мерцание изображени. Решается путем замены на новый шлейф или ремонт с пропайкой провадов

Замена шлейфа жесткого диска

Достаточно часто шлейф надрывают при снятии или установки жесткого диска, решается проблема только заменой шлейфа на новый.

Стоимость замены матрицы Fujitsu
Виды работЦены
Диагностика ноутбукабесплатно
Ремонт шлейфа матрицы800
Замена шлейфа матрицы (работа + запчасть)
2000-3500
Ремонт шлейфа hdd1000
Замена шлейфа hdd, cd/dvd1000-2500
 

Пайка шлейфа матрицы телевизора Samsung

Пайка шлейфа матрицы телевизора Samsung

Телевизор перестал показывать изображения, есть дефекты картинки, которые мешают комфортному просмотру – приносите его в сервисный центр. Пайка или замена матрицы Samsung проходит после бесплатной диагностики, делаем ремонт по доступной стоимости и без задержки указанных сроков. Для починки есть весь набор необходимого оборудования.

Полосы на LCD мониторе, искажения или отсутствие изображения могут свидетельствовать о неисправности соединительного кабеля, который подключает экран к материнской плате устройства. Возможно, шлейф отошел или поврежден, и нужно провести деликатную разборку с последующим восстановлением ТВ устройства. Такое сложно сделать в домашних условиях, тем более, не следует доверять починку неопытным мастерам и непроверенным мастерским. Лучше быть уверенными в результате и обращаться к узкоспециализированным инженерам нашего сервиса. Оперативно найдем поломку и устраним ее, при этом вы получаете официальную гарантию на проведенное восстановление.

Замена шлейфа матрицы Samsung

О неисправности ЖК дисплея говорят следующие симптомы:

  • мерцание с постоянной или переменной интенсивностью;
  • во время просмотра передач появляется рябь;
  • пятна геометрической формы, вертикальные, горизонтальные полосы.

Также жидкокристаллический дисплей мог полностью выйти из строя и вовсе не показывать изображение. Чаще всего замена шлейфа матрицы телевизора Самсунг требуется после сильного удара по корпуса, падения, физического повреждения устройства. Это провоцирует обрыв хрупких контактных групп. Кроме того, могла произойти внутренняя коррозия устройства, которую спровоцировало попадание капель воды, из-за чего на внутренних контактах и дорожках платы запустились окислительные процессы. Происходит это, как правило, после протирки телевизора Samsung влажной тряпкой. Особенно ситуацию усугубляет попадание химического раствора.

Как только с электроникой возникли проблемы, пользователи начинают искать решение проблемы на форумах, пытаясь найти причину, а затем самостоятельно починить любимую технику. Однако без специализированного сервисного оборудования и при отсутствии практических навыков это только усугубляет ситуацию, что приводит к удорожанию последующего восстановления. Поэтому, обнаружив неисправность, не спешите решать ее сами – сразу обращайтесь в наш сервисный центр.

Проводим профессиональный ремонт матрицы Smart TV, замена шлейфа в телевизорах Самсунг проходит в стерильных условиях, ее осуществляют опытные мастера, которые не раз восстанавливали фирменную технику. Не усложняйте починку и не поднимайте ее стоимость самовольным вмешательством – оставляйте заявку на сайте или по телефону.

Профессиональное обслуживание фирменной техники

Перед тем, как провести ремонт шлейфа матрицы в Смарт ТВ, устройство необходимо доставить в сервис. Можно не таскаться с громоздкой техникой и заказать услугу курьерской службы. Для этого при заявке укажите адрес или ближайшую остановку общественного транспорта, чтобы в назначенный час подъехал наш сотрудник и забрал электронику к сервисным инженерам для проведения ремонтной процедуры.

После того, как телевизор Samsung попал к мастерам, сразу начинаем его осматривать. Бесплатную диагностику осуществляем два раза – до и после восстановления для проверки качества выполненной работы. Деликатно руками снимаем крышку, для этого используем подручные инструменты. Открыв доступ к материнской плате и шлейфам, проверяем их состояние, при необходимости проводим чистку от нагара и налета, которые появился в результате окисления.

Определив источник проблемы и неисправную деталь, звоним клиенту и озвучиваем сроки починки и стоимость работ. Пайка шлейфа матрицы Самсунг выполняется опытным специалистом, который деликатно возвращает ТВ устройство к прежней исправной работе. Затем полученный результат проверяется в отделе контроля по качеству.

Гарантия на услуги сервиса

В целом, работа проходит по отлаженному алгоритму:

  • электроника попадает в сервис, где тщательно ее диагностируем и определяем поломки;
  • согласуем с клиентом конечную цену со сроками;
  • выполняем профессиональный ремонт телевизора Samsung;
  • проверяем результат в отделе по качеству и выдаем официальную гарантию на проведенные работы.

Узкоспециализированные сервисные инженеры чинят фирменную технику без выходных, праздничных дней. Заявки на обслуживание принимаются круглосуточно. Обратиться к нам за помощью можно в режиме онлайн, достаточно оставить обращение или заказать обратный звонок менеджеров. Также звоните по указанному телефону: ответим на возникшие вопросы и поможем составить заявку.

LoopFix: подход к автоматическому ремонту петель с ошибками

Ван, Weichao в настоящее время является доктором философии. студентка Тяньцзиньского университета. Он получил степень бакалавра компьютерных наук и степень магистра программной инженерии в Пекинском университете в 2011 и 2014 годах соответственно. Его исследовательские интересы включают тестирование программного обеспечения и анализ программ параллелизма.

Мэн, Чжаопенг в настоящее время является профессором школы компьютерного программного обеспечения Тяньцзиньского университета и вице-президентом Тяньцзиньского университета традиционной китайской медицины.Он получил докторскую степень. степень в области компьютерных наук и технологий Тяньцзиньского университета. Его исследовательские интересы включают большие данные, программное обеспечение и системы Интернета вещей, компьютерное зрение и взаимодействие человека с компьютером.

Ван, Зан в настоящее время является доцентом Тяньцзиньского университета в Китае. Он получил степень бакалавра прикладной математики, степень магистра вычислительной техники и степень доктора наук в области информационных систем в Тяньцзиньском университете (TJU) в 2000, 2004 и 2009 годах соответственно.Он был преподавателем Тяньцзиньского университета с 2010 года. В 2013 году он был приглашенным научным сотрудником в UT Dallas. Научные интересы Зана включают тестирование программного обеспечения, анализ программ параллелизма и обработку естественного языка.

LIU, Шуанг в настоящее время является адъюнкт-профессором Тяньцзиньского университета, Китай (TJU). Она получила степень бакалавра в Китайском университете Жэньминь (RUC) в 2010 году, степень доктора компьютерных наук в Национальном университете Сингапура (NUS) в 2015 году. В 2015-2016 годах она работала постдокторантом в SUTD, а в 2016 году — лектором в SiT. 2017 г.Она является преподавателем TJU с октября 2017 года. Научные интересы Шуанг включают разработку программного обеспечения, формальные методы и защиту конфиденциальности.

Хао, Цзянье в настоящее время является доцентом школы компьютерного программного обеспечения при Тяньцзиньском университете. Он получил докторскую степень. степень бакалавра компьютерных наук и инженерии Китайского университета Гонконга в 2013 году и степень бакалавра наук. получил степень в Школе компьютерных наук и технологий Харбинского технологического института в 2008 году.Его исследовательские интересы включают искусственный интеллект, многоагентные системы, машинное обучение и теорию игр.

© 2019 Elsevier Inc. Все права защищены.

Ремонт петель ДНК включает несоответствие ДНК и белки эксцизионной репарации нуклеотидов

Мы исследовали влияние мутаций msh3 и rad1 на паттерны мейотической сегрегации гетерозиготных маркеров в гене HIS4 , горячей точке рекомбинации 5 . Msh3 (гомолог белка MutS Escherichia coli ) необходим для репарации как замен оснований-оснований, так и небольших петель ДНК, действуя вместе с Msh4 или Msh6 и гомологами MutL Mlh2 и Pms1 (ссылки 6, 7) .Rad1 действует вместе с Rad10, чтобы расщеплять 5′-димер пиримидина во время эксцизионной репарации нуклеотидов 1 . Мы использовали два разных типа мутантных аллелей his4 : his4-lopd (непалиндромная вставка из 26 пар оснований (п.н.) в HIS4 ; ссылка 5) и his4-AAG (основание- изменение пары в инициирующем кодоне ATG HIS4 ; ссылка 8). Диплоидные штаммы, гетерозиготные по одному из этих аллелей и гомозиготные по rad1 , msh3 или обе мутации, спорулировали и тетрады препарировали.Колонии спор, выращенные на богатой среде, помещали в реплики на среду без гистидина и оценивали как His + , His и разделяли на His + / His (представляющие события PMS) (таблицы 1 и 2).

Таблица 1 Влияние мутаций rad1 и msh3 на паттерны мейотической сегрегации гетерозиготных маркеров в локусе HIS4 Таблица 2 Влияние мутаций rad1 и msh3 на частоты аберрантной сегрегации и кроссовера частоты в диплоидных штаммах, гетерозиготных по his4-lopd или his-AAG

В DNY27, штамме дикого типа, гетерозиготном по his4-lopd , только 12% событий аберрантной сегрегации представляют собой события ПМС, что указывает на то, что Предполагаемая петля из 26 оснований в гетеродуплексе эффективно распознается и восстанавливается.Гомозиготные мутации rad1, или msh3 увеличивают частоту ПМС примерно в три раза, демонстрируя, что Rad1 и Msh3 участвуют в репарации больших петель ДНК. Более того, они функционируют в одном и том же пути репарации, поскольку мутант rad1 msh3 имеет ту же частоту PMS, что и штаммы rad1 и msh3 . Неожиданно мутация rad1 также значительно увеличивает частоту ПМС для his4-lopd при гетерозиготности, что позволяет предположить, что продукт гена RAD1 может ограничивать скорость репарации в пути, зависимом от RAD1 MSh3 .Мутации rad1, и msh3 не оказывают существенного влияния на частоту кроссовера в интервале HIS4 LEU2 (таблица 2).

В штамме дикого типа, гетерозиготном по точечной мутации his4-AAG (PD83), мы обнаружили, что 14% аберрантных сегрегантов были ПМС (таблица 2). Мутация rad1 немного (но значительно ( P = 0,03)) увеличивала частоту ПМС. В производном msh3 , PMS составлял 87% от общего числа случаев аберрантной сегрегации, как ожидалось из предыдущих исследований 9 .Из этих результатов мы предполагаем, что Rad1 играет меньшую роль в мейотической репарации несоответствий основание-основание, чем в репарации петель. В предыдущих исследованиях 10 , 11 не наблюдалось влияния мутации rad1 на частоту гетерозиготных мутаций (предположительно точечных мутаций) ПМС, хотя кроссинговер снижался в диплоидах rad1 , облученных ультрафиолетом 12 .

Система эксцизионной репарации нуклеотидов (NER) у дрожжей требует согласованного действия большого количества белков.Эндонуклеазы NER, Rad1 / Rad10 и Rad2, расщепляют 5 ‘и 3’ димера пиримидина соответственно, тогда как Rad14, по-видимому, участвует в распознавании повреждений ДНК 1 . Чтобы определить, требуется ли для репарации больших петель, наблюдаемых с помощью Rad1, другие белки NER, мы исследовали эффекты мутаций rad2 и rad14 на сегрегацию his4-lopd (DTK241 и DTK242; Таблица 1). Ни одна из мутаций не увеличивала частоту ПМС, указывая на то, что полный комплекс NER не требуется для репарации больших петель ДНК.

Поскольку мутации his4-AAG и his4-lopd расположены на расстоянии около 470 п.н. друг от друга в HIS4 , альтернативное объяснение наших результатов состоит в том, что Rad1 влияет на репарацию несоответствия ДНК в зависимости от положения мутации. внутри гена. Следовательно, мы исследовали эффекты мутации rad1 на паттерн аберрантной сегрегации his4-Sal , вставки из 4 пар оснований, расположенной в том же положении, что и his4-lopd . Мы обнаружили, что ни один из аберрантных сегрегантов не был тетрадой ПМС (Таблица 1).Поскольку мы ранее обнаружили сходные паттерны сегрегации для his4-Sal в штамме RAD1 5 , мы пришли к выводу, что Rad1 специфически влияет на репарацию больших петель ДНК.

Есть несколько других интересных моментов, связанных с таблицами 1 и 2. Во-первых, для штаммов с мутацией his4-lopd мы обнаружили, что rad1 увеличивает частоту как 5: 3, так и 3: 5 тетрад и снижает частоту 2: 6 тетрад, но не влияет на частоту тетрад 6: 2 (сравните DNY27 и TP1013).Этот результат предполагает, что Rad1 используется для репарации восстановления для петель, в которых цепь дикого типа передается при формировании гетеродуплекса (рис. 1a), потому что потеря репарации восстановления приведет к увеличению числа событий 5: 3 без изменения 6: 2 события. Rad1 может использоваться для репарации конверсии в гетеродуплексах, в которых мутантная цепь является донорской (рис. 1b), потому что потеря репарации конверсии может приводить как к усилению событий 3: 5, так и к потере событий 2: 6. Таким образом, Rad1 может участвовать в репарации, при которой цепь дикого типа вырезается из гетеродуплекса, потому что такими событиями являются восстановление, когда цепь дикого типа передается, и преобразования, когда передается цепь мутантного типа (рис.1). Альтернативно, поскольку последовательности при несовпадении зависят от того, какая цепь передана, Rad1 может играть специфичную для последовательности роль в репарации. Обратите внимание, что наблюдается увеличение ПМС без компенсирующего снижения классов 6: 2 или 2: 6 для штаммов msh3 и rad1 msh3 , содержащих мутацию his4-lopd (Таблица 2). Либо количество тетрад, проанализированных для этих штаммов, было слишком маленьким, чтобы обнаружить измененное соотношение классов 6: 2 и 2: 6, либо роли Rad1 и Msh3 в репарации петель немного различаются.

Во-вторых, в штамме msh3 , гетерозиготном по his4-AAG , увеличение PMS уравновешивается общим снижением конверсии (таблица 2). Это указывает на то, что Msh3 требуется в первую очередь для ремонта конверсионного типа для his4-AAG и восстановления типа восстановления для his4-lopd . Это различие, вероятно, отражает природу несоответствия ДНК (петля по сравнению с несоответствием основание-основание), потому что ранее было обнаружено, что мутация msh3 повышает ПМС и снижает конверсию гена для несовпадений оснований, распределенных по всему гену HIS4 . 9 .

Наши результаты демонстрируют ранее необнаруженную потребность в Msh3 для репарации больших петель, образующихся во время мейотической рекомбинации. Предыдущие исследования показали, что msh3 увеличивают PMS для гетерозиготных замен оснований и для вставок 4 bp 9 , 13 . Мутации в MutL гомологе MLh2 приводят к увеличению PMS для локусов MAT (которые различаются большой областью гетерологии) (Н. Хантер и Р. Бортс, личное сообщение), тогда как мутации в PMS1 (другой гомолог MutL ) не увеличивает частоту ПМС для гетерологии из 38 п.н. 3 .Msh3 может связывать ошибочные спаривания оснований и петли ДНК in vitro в отсутствие других белков репарации несовпадений 14 , но неясно, участвуют ли другие гомологи MutS и MutL или совершенно другой путь репарации в Msh3-зависимой петле. ремонт в мейозе. В митотических клетках мутанты msh3 , по-видимому, неспособны эффективно корректировать петли из 20 оснований или больше, которые возникают в результате проскальзывания ДНК-полимеразы 15 , 16 , но эти исследования не смогли обнаружить небольших эффектов.

Сообщалось о других связях между системами восстановления несоответствия и удаления нуклеотидов. Например, активность репарации ошибочного спаривания человеческого MutSα может распознавать объемные аддукты, обычно репарируемые белками NER 17 , 18 , хотя репарация этих аддуктов системой репарации ошибочного спаривания не была продемонстрирована. Напротив, система NER может восстанавливать несоответствия основание-основание, хотя и намного менее эффективно, чем димеры пиримидина 19 . Было показано, что с некоторыми субстратами прямого повтора msh3 снижает митотическую рекомбинацию в той же степени, что и rad1 , а мутации msh3 rad1 имеют примерно такой же эффект, как и одиночные мутации, что указывает на то, что Msh3 и Rad1 могут функционировать в одинарный путь 20 .Кроме того, Msh3 и Msh4 необходимы для Rad1 / Rad10-зависимого удаления негомологичных хвостов из двухцепочечных разрывов, но не играют последующей роли в митотической DSB-индуцированной рекомбинации (N. Sugawara, F. Paques, M. Colaiacovo и Дж. Хабер, личное сообщение). Наконец, мутации в Drosophila гомологе RAD1 , mei-9 (ссылка 21) увеличивают PMS 22 .

Наши результаты показывают, что и Rad1, и Msh3 участвуют в мейотической репарации больших петель ДНК.Поскольку мы все еще наблюдаем конверсию мейотического гена в штамме rad1 msh3 his4-lopd , должен существовать независимый путь RAD1 MSh3- для мейотической репарации петель ДНК. Например, некоторые события конверсии гена могут не включать гетеродуплексные промежуточные соединения. Каким бы ни был механизм, наши результаты свидетельствуют о множественных путях конверсии мейотических генов.

Ремонт вилки

Как отремонтировать хомут петли с пропилом
Эти простые в использовании инструкции дадут вам наилучшие шансы на успех
при повторном запечатывании вилки петли с пропилом.

У вас есть шлейф, который показывает сопротивление ниже 30 МОм? Этот метод повторной герметизации может устранить замыкание петли, если короткое замыкание происходит в точке ярма (область, где петля встречается с вводом), которая часто является уязвимой точкой для петель.

Шаг 1:

Осторожно прорежьте герметик по бокам в области вилки с помощью канцелярского ножа. Не обрезайте область, в которой петля входит и выходит из кокетки.
Удар отверткой по краям разреза может помочь отделить герметик от дорожного покрытия. Будьте осторожны, чтобы не проткнуть контурный провод.


Шаг 2: С помощью плоскогубцев и отвертки извлеките старый герметик. Будьте осторожны, вставляя отвертку, убедитесь, что она не вдавливается в петлю.

Шаг 3:
Удалите как можно больше герметика в области вилки.

Шаг 4:

Вставьте тонкую отвертку между проводами контура и осторожно раздвиньте провода. Это позволит герметику протечь между проводами. Используйте воздуходувку
или баллончик с воздухом , чтобы удалить неплотный мусор, прежде чем заливать герметик. Протрите медицинский спирт вокруг стыка, а затем продуйте его / высушите, чтобы обеспечить чистую поверхность для прилипания нового герметика.

Шаг 5:
Не снимая отвертку, нанесите слой герметика под вилку, осторожно вдавите вилку в герметик.

Не используйте герметик на водной основе, используйте резиновый или полиуретановый герметик. Герметики на водной основе облегчат замыкание на землю.

Примеры полиуретановых герметиков Примеры герметиков на резиновой основе

BD Loop Goop
Chemque Q-SEAL ™ 290S
Bondo® 575 Loop Sealant BASF Gold Label Loop Sealant
Sikaflex®-1a
Или совместимые продукты

Ruscoe Permanent Sealer 974 Loop Sealant
3M Detector Loop Sealant 5000
Или совместимые продукты

Шаг 6:
Вставив отвертку, оставьте уплотнение на вилке.Залейте вилку герметиком.

Шаг 7:
Удалите отвертку, это позволит герметику течь между проводами контура.

Эти шаги помогут восстановить только петлю, выходящую из строя в точке ярма (область, где петля встречается с вводом). Полное уплотнение этой области предотвратит попадание воды в точку ярма и вызовет замыкание на землю или периодические сбои контура.Если ваша петля была повреждена в другом месте, этот ремонт не исправит петлю.

Брайан Диксон — генеральный директор BD Loops, разработчик предварительно отформованных контуров индуктивности прямого закапывания и пропила для ворот, дверей и парковок. Брайан имеет сертификат CAGOI и сертифицированный тренер IDEA. За более чем 13 лет работы компания BD Loops по качеству не имеет себе равных. Продукция BD Loops доступна более чем у 300 дистрибьюторов в США и Канаде. BD Loops предлагает 46 стандартных размеров предварительно отформованных петель, все стандартные и нестандартные размеры петель готовы к отправке в тот же день.Компания имеет несколько рекомендательных писем, свидетельствующих об их профессионализме и дизайне, и является членом следующих ассоциаций: AFA, IDA, NOMMA, IPI, CODA, NAFCA и IMSA. Если вы хотите поговорить с Брайаном Диксоном, позвоните в BD Loops по телефону 714-890-1604.

Как отремонтировать берберский (или любой другой) ковер за 5 минут или меньше

Заедание в ковре?

Это один из немногих случаев, когда исправить будет проще , чем вы ожидаете.

Существует 3 типа ремонта заедов в зависимости от ваших целей:

  • просто ограничение дальнейшего ущерба
  • ремонт небольшого (одно- или двухпетлевого) зацепа
  • ремонт более длительного «пробега» (зацеп, тянущий несколько петель) в ковре

После ремонта коряги я также расскажу, как легко исправить необратимые повреждения берберского ковра с помощью ремонтного комплекта внизу этой страницы. Это может быть вырванный участок, невыносимое пятно или ожог ковра.

Если вам нужна помощь в поиске квалифицированного установщика, я рекомендую HomeAdvisor, потому что они делают домашнюю работу по установщику за вас. Щелкните здесь , чтобы ввести свой почтовый индекс и связаться с 3 установщиками в вашем районе ИЛИ позвоните по этому номеру: (888) 231-5203. Я получаю небольшую комиссию, если вы воспользуетесь их услугами, но я считаю, что это отличный сервис.

Самый простой способ исправить потянувшуюся петлю или зацепку (2-минутный ремонт)

Проблема с заедами в том, что они имеют тенденцию распутываться, так что небольшая зацепка может оказаться большой зацепкой.

Чтобы этого не произошло, есть простой двухминутный ремонт. Это не лучший ремонт, но если вы просто хотите ограничить ущерб или устранить небольшую загвоздку, иногда он отлично работает.

Необходимые инструменты:

  • пистолет для горячего клея
  • отвертка с плоской головкой (в качестве альтернативы нож для масла или другой тупой предмет)
Шаг 1. Проверьте, сможете ли вы протолкнуть застрявшую петлю вниз.

Иногда можно воспользоваться отверткой. (или даже пальцем) и протолкните вытянутую петлю обратно в ковер, и это выглядит великолепно! Часто после этого вы вряд ли сможете заметить разницу в поврежденной области.

Если он выглядит хорошо, переходите к шагу 2.

Если он слишком большой, чтобы отодвинуть его назад, или просто не выглядит правильным, другой вариант — вырезать застрявшую петлю. Это убирает его с пути, поэтому он не может зацепиться и распутаться дальше.

Шаг 2: Приклейте

Возьмите горячий клей или суперклей и приклейте то место, которое вы прижали. Это сделает 2 вещи: удержит ремонт на месте, но также предотвратит дальнейшее заедание.

Шаг 3. Вы закончили

Что ж, это было просто.Шага 3 нет. Но имейте в виду, что этот ремонт, вероятно, не подойдет для более длинных препятствий, также известных как пробеги. Вы можете попробовать подтолкнуть волокна ковра вниз перед приклеиванием и посмотреть, как он выглядит, но я предполагаю, что вы захотите перейти к следующей процедуре:

Ремонт ковров или больших коряг (ремонт за 30 минут) )

Иногда ваш пылесос выдергивает большие пряди вашего бербера, или у вас уже была загвоздка, которую поймали и потянули дальше, создавая пробежку по ковру.

(примечание: ознакомьтесь с нашими лучшими пылесосами для берберских страниц, чтобы узнать о пылесосах, которые отлично работают, не задевая ковер с петлями)

Обычно вам лучше всего заменить ковер на месте. Это не так просто, как наш предыдущий ремонт, но я все же думаю, что вы можете сделать это за 30 минут.

Необходимые инструменты

  • Универсальный нож
  • Пистолет для горячего клея (или суперклей)
  • «Остаточный» ковер

По этой причине некоторые монтажники оставляют после себя лишнее ковровое покрытие.В противном случае вы можете удалить часть из менее заметного места (например, в туалете) и повторно использовать его для ремонта.

Теперь подробности ремонта:

Шаг 1: Вырежьте поврежденный участок

С помощью универсального ножа прорежьте поврежденный участок ковра полностью до основы ковра. Постарайтесь подойти как можно ближе к неповрежденным коврам, не разрезая их.

Шаг 2. Отрежьте «оставшийся» ковер

Измерьте размер вырезанной области. Вырежьте ковер такого же размера и формы, чтобы он точно соответствовал поврежденному участку. Примечание: некоторые люди сокращают это, помещая «оставшийся» ковер поверх настоящего ковра и вырезая оба ковра одновременно (поврежденную область и «остатки»), чтобы они точно совпадали. Хитрость здесь в том, что вы должны измерить размер поврежденного участка и немного выйти за его пределы, поскольку «оставшийся» ковер будет покрывать повреждение.

Шаг 3: Установите «оставшийся» ковер

Поместите донорский ковер в область, где вы вырезали поврежденный участок, и положите его на неповрежденные участки.Чтобы он оставался на месте, можно нанести на нижнюю часть ковра суперклей и прижать его согласно инструкции. Если это правильный размер, будет намного легче сделать его ровным и ровным с остальной частью вашего ковра.

Набор для ремонта ковров Berber для необратимых повреждений

Иногда у вас либо разорванный участок, либо стойкое пятно (примечание: у меня есть страница о том, как вытащить красное вино из ковра), либо ожог, который невозможно отремонтировать. чем заменить площадь. Лучше всего это сделать с помощью ремкомплекта, который упростит задачу.

Мне нравится этот ремкомплект. Он прост в использовании и стоит своих денег. Вы можете сделать это вручную, но добиться идеального соответствия сложно. Вот как вы его используете:

  1. Используйте лезвия в круглом устройстве, чтобы вырезать поврежденный участок вашего ковра.
  2. Используйте лезвия в круглом устройстве, чтобы отрезать кусок от запасного ковра (у большинства людей есть запасной кусок ковра — остатки ковра — но вы также можете вырезать место в шкафу или под мебелью, если в крайнем случае)
  3. Добавьте белый диск клея к области удаленного ковра
  4. Прижмите новый кусок ковра к клею

Вот и все ! Легко!

Напутствие капитана!

Если можете, исправьте ошибку за 2 минуты.На небольших препятствиях вы никогда не узнаете, где это произошло, и это предотвращает дальнейшее повреждение (например, когда вы получаете вмятину от камня на лобовом стекле — это предотвращает распространение трещины).

Но при необходимости вы можете заменить поврежденную часть вашего ковра. А если просто не хочется, всегда можно нанять профессионала. Многие мастера по установке ковров и некоторые чистильщики ковров справятся с этой задачей.

Есть вопросы по ремонту коврового покрытия? Позвольте мне знать в комментариях ниже.

Краткое руководство по ремонту индукционной петли

Мы получаем много звонков от запаниковавших подрядчиков, которые случайно повредили ленту индукционной петли (фольгу). Мы создали это краткое руководство о том, как устранить повреждение за четыре простых шага.

Система индукционной индукции звуковой частоты (A.F.I.L.S.) — это вспомогательная система прослушивания для тех, кто страдает потерей слуха и использует слуховой аппарат. Система состоит из источника аудиовхода (микрофона или звуковой системы), усилителя (ов) и медной ленты / кабеля, которые обычно проходят по периметру зоны, которую должна охватывать система.Пользователь слухового аппарата переключает слуховой аппарат в режим «Т» (индукционная катушка), чтобы слышать звук прямо в слуховой аппарат.

Существуют различные типы систем с индукционной петлей, но обычно лента / кабель используются только в системах с индукционной петлей, которые покрывают всю комнату или территорию. Лента индукционной петли используется вместо кабеля под напольными покрытиями, такими как ковры, винил и ламинат из-за ее низкого профиля.

Лента индукционной петли обычно покрывается предупреждающей лентой, чтобы предупредить подрядчиков, чтобы они не повредили ее, но, поскольку она обычно находится под материалом пола (ковер, винил и т. Д.), Она часто скрыта.Лента сделана из изолированной меди и обычно зажата между двумя слоями ленты Gaffa (бак). Это используется только для остановки движения медной ленты во время установки, поэтому она не защищает от ножей или других инструментов. При поднятии материала пола можно очень легко повредить его, особенно если он приклеен.

Для работы индукционной петли лента должна быть целой. Если лента повреждена или порезана, усилитель обычно обнаруживает неисправность и отключается.

Шаг 1.Проверить петлю

Лента индукционной петли будет подключена к кабелю на каждом конце, чтобы ее можно было подключить к усилителю индукционной петли. Это будет либо с помощью соединительных штырей, либо с помощью вилки на задней панели усилителя. Отсоедините кабель от усилителя (отметив полярность, если усилитель имеет два выхода или присутствуют два или более усилителя).

Используйте омметр или мультиметр, запрограммированный для измерения сопротивления, чтобы проверить, является ли индукционная петля разомкнутой (т.е.е. не отображает сопротивление из-за того, что не образует конкурирующую цепь). Если два усилителя (или один усилитель с двумя выходами) питают одну и ту же зону, то может быть полезно сравнить сопротивление двух контуров, так как обычно они будут одинаковыми. Типичное сопротивление должно быть в пределах 0,5–2,5 Ом (Ом).

Если сопротивление отсутствует или очень высокое, значит, лента повреждена.

Наконечник. Убедитесь, что контакты омметра / мультиметра имеют хороший контакт с кабелем индукционной петли, чтобы не давать ложных показаний.

Шаг 2. Найдите повреждение

Это может быть очень сложно, но всегда начинайте там, где недавно проводились строительные работы. Если нет очевидной области, где была нарушена лента петли, попробуйте отследить ленту и начать проверку целостности в различных областях. Если петельная лента установлена ​​по периметру, начните проверку сопротивления между каждым углом комнаты. Если у вас есть показания сопротивления только с трех сторон, то повреждение будет между углами, где вы не можете увидеть показания.

Часто повреждение происходит более чем в одном месте, поэтому, если вы ремонтируете одну секцию, а петля все еще имеет высокое сопротивление или его нет, продолжайте искать дополнительные повреждения!

Обнаружив повреждение, осторожно удалите предупреждающую ленту и ленту Gaffa, чтобы получить доступ к медной фольге.

Наконечник. Иногда ковровым ножом можно чисто разрезать ленту, что может привести к переменным результатам, в результате чего петля будет прерывистой. Один из способов помочь найти это повреждение — попросить кого-то наблюдать за счетчиком, пока другой шаркает ногами по ковровой дорожке выше того места, где была установлена ​​петля.Если сопротивление внезапно изменится на определенном участке ковра, вероятно, будет повреждена петельная лента под ним.

Только одна из лент индукционной петли на этой фотографии была повреждена. Несмотря на то, что на второй ленте был нанесен нож, лента (и ее прозрачная изоляция) остались целы.

Шаг 3. Отремонтировать поврежденную ленту

Острым лезвием осторожно соскоблите примерно 20 мм прозрачной внешней изоляции петлевой ленты, чтобы обнажить чистую медь.Используйте паяльник и припой, чтобы залудить каждый конец петлевой ленты.

Отрежьте небольшой кусок петельной ленты, осторожно соскребая прозрачную внешнюю изоляцию с каждой стороны, прежде чем покрыть ее припоем. Этот кусок петельной ленты должен быть достаточно длинным, чтобы перекрыть повреждение установленной ленты. Поместите новый кусок ленты на поврежденный кусок и спаяйте их вместе, по одной стороне за раз.

Петельная лента, используемая для ремонта повреждения, должна быть такого же размера, как и установленная лента.

Наконечник. Поместите тонкий лист нержавеющей стали (или аналогичного материала) под фольгу (не показана) при ее пайке, чтобы не повредить окружающую Gaffa / бак / предупреждающую ленту или окружающие материалы.

Шаг 4. Проверить ремонт

Подключите омметр / мультиметр к концам контура и еще раз проверьте сопротивление. Если сопротивление теперь правильное, вы можете повторно изолировать петлевую ленту с помощью ленты Gaffa / tank. После закрытия снова подсоедините кабель индукционной петли к усилителю и включите его.

Для проверки индукционной петли на усилитель (усилители) должен подаваться входной сигнал. Индикаторы будут мигать на экране выходного сигнала усилителя, показывая, что по контуру протекает ток. Затем следует использовать приемник для проверки контура, чтобы прослушать систему контура, чтобы проверить чистоту звука и отсутствие искажений.

(Приемник для тестирования контура — это компактное устройство с батарейным питанием, которое имитирует слуховой аппарат, настроенный на программу «T». Наушники подключаются к приемнику, чтобы слышать звук)

Приемник индукционной петли следует удерживать примерно на 1 шт.2 м от пола, если зона обычно используется сидящими людьми, например церковь, или 1,7 м для площади, обычно используемой стоящими людьми, например концертная площадка. Большинство приемников следует держать в вертикальном положении.

Предупреждающая лента должна быть снова наклеена поверх петлевой ленты, чтобы предупредить других подрядчиков!

Популярные приемники индукционной петли —

Ампетроник ILR 3 / ILR 3+

Контакты IL-RX 20

Пленку индукционной петли и предупреждающую ленту можно приобрести здесь.

Эксцизионное восстановление нуклеотидов, восстановление несоответствия и R-петли модулируют конвергентную гибель клеток, индуцированную транскрипцией, и нестабильность повторения

Abstract

Расширение CAG • CTG-тракты, расположенные в определенных генах, ответственны за 13 нейродегенеративных заболеваний человека, патогенетические механизмы которых еще не определены. Эти гены болезни повсеместно экспрессируются в тканях человека, и транскрипция была идентифицирована как один из основных путей дестабилизации повторов.Вызванная транскрипцией нестабильность повтора зависит от эксцизионной репарации связанных с транскрипцией нуклеотидов (TC-NER), компонента распознавания репарации ошибочного спаривания (MMR) MSh3 / MSh4 и гибридов РНК / ДНК (R-петель). Недавно мы сообщили, что одновременная смысловая и антисмысловая транскрипция — конвергентная транскрипция — посредством повтора CAG не только способствует нестабильности повтора, но также индуцирует реакцию клеточного стресса, которая останавливает клеточный цикл и в конечном итоге приводит к массовой гибели клеток через апоптоз. Здесь мы используем нокдауны siRNA, чтобы исследовать, модулируют ли NER, MMR и R-петли также гибель клеток, вызванную конвергентной транскрипцией, и нестабильность повторов.Мы обнаружили, что опосредованное siRNA истощение компонентов TC-NER увеличивает конвергентную индуцированную транскрипцией гибель клеток, как и одновременное истощение РНКазы h2 и РНКазы h3A. Напротив, истощение MSh3 снижает гибель клеток. Эти результаты идентифицируют TC-NER, распознавание MMR и R-петли как модуляторы конвергентной гибели клеток, индуцированной транскрипцией, и проливают свет на задействованный молекулярный механизм. Мы также обнаружили, что путь TC-NER, MSh3 и R-петли модулируют конвергентную индуцированную транскрипцией нестабильность повторов.Эти наблюдения связывают механизмы индуцируемой конвергентной транскрипцией повторяющейся нестабильности и индуцированной конвергентной транскрипцией гибели клеток, предполагая, что общая структура может запускать оба исхода.

Образец цитирования: Lin Y, Wilson JH (2012) Эксцизионное восстановление нуклеотидов, восстановление несоответствия и R-петли модулируют гибель клеток, индуцированную конвергентной транскрипцией, и нестабильность повторения. PLoS ONE 7 (10): e46807. https://doi.org/10.1371/journal.pone.0046807

Редактор: Тецуо Ашизава, Университет Флориды, Соединенные Штаты Америки

Поступила: 01.05.2012; Принята к печати: 7 сентября 2012 г .; Опубликовано: 3 октября 2012 г.

Авторские права: © Lin, Wilson.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Финансирование: Эта работа была поддержана грантом NIH (GM38219) компании J.H.W. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Введение

Тандемные повторяющиеся последовательности, которые являются основными составляющими теломер и центромер хромосом, распределены по всему геному человека [1]. Расширения трактов CAG • CTG в любом из нескольких специфических генов человека приводят к нарушениям, обычно характеризующимся нейродегенерацией, из-за потери или гибели нейронов в специфичных для заболевания областях мозга. К настоящему времени было обнаружено, что тринадцать тринуклеотидных (TNR) расстройств вызваны расширением тракта CAG • CTG, включая болезнь Хантингтона (HD), HD-подобный 2 (HDL2), миотоническую дистрофию 1 типа (DM1), спинномозговую и бульбарную мышечная атрофия (SBMA), дентаторубрально-паллидолизиальная атрофия (DRPLA) и спиноцеребеллярная атаксия SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA12 и SCA17 [2], [3], [4].Молекулярная основа этих заболеваний с повторением CAG (в дальнейшем — заболевания CAG) — это расширение повторяющегося тракта за пределы порогового числа повторяющихся единиц для конкретного заболевания. По причинам, которые не совсем ясны, длинные участки повторов CAG становятся нестабильными, с сильным уклоном в сторону экспансии как в зародышевой линии, так и в соматических клетках [5]. Расширение в зародышевой линии приводит к более длинным повторам в потомстве, наряду с увеличением тяжести заболевания и более ранним возрастом появления симптомов заболевания, в то время как экспансия в соматических клетках, особенно в нейронах, ускоряет прогрессирование заболевания [3], [4], [6] , [7].

Одной из важнейших тем для понимания и лечения заболеваний CAG является механизм экспансии повторов CAG во время передачи по зародышевой линии и в соматических клетках. Предыдущие исследования с использованием бактерий, дрожжей, мух, клеток млекопитающих и модельных систем мышей показали, что повторяющаяся нестабильность может возникать в связи практически с любым метаболическим путем ДНК, включая репликацию ДНК, репарацию ДНК, рекомбинацию и транскрипцию [6], [8] ], [9], [10], [11], [12]. Эти процессы могут различаться по своей относительной важности для повторения нестабильности в разных типах клеток человека [3], [5], [13].Например, ожидается, что репликация ДНК будет более важным фактором нестабильности повтора в пролиферирующих половых клетках, чем в терминально дифференцированных нейронах [12]. Несколько генетических наблюдений на мышах подтверждают идею о множественных тканеспецифических механизмах повторяющейся нестабильности: делеция одной копии гена Dnmt1 (ДНК-метилтрансфераза 1) увеличивает нестабильность в мужских и женских зародышевых линиях, но не в соматических клетках [ 14]; нули для компонента эксцизионной репарации оснований, Ogg1 (8-оксогуанингликозилаза), снижают нестабильность в соматических тканях, но не влияют на зародышевую линию [15], [16]; и нокаут гена Xpa , который кодирует ключевой компонент эксцизионной репарации нуклеотидов (NER), практически устраняет повторяющуюся нестабильность в нескольких специфических областях мозга, но не влияет на нестабильность в печени, почках или какой-либо зародышевой линии [17].Эти исследования показывают, что разные пути участвуют в создании повторяющейся нестабильности в определенных тканях.

Исследования на клетках человека и дрозофилы первоначально показали, что транскрипция в сочетании с репарацией ДНК способствует нестабильности CAG в эукариотических клетках [18], [19]. Считается, что транскрипция, временно обнажая отдельные цепи ДНК, позволяет длинным участкам повторов CAG формировать аномальные вторичные структуры, такие как шпильки и дуплексы ДНК со скользящей цепью, которые затем задействуют процессы репарации ДНК [20], [21].Подробные исследования на клетках человека показали, что связанная с транскрипцией эксцизионная репарация нуклеотидов (TC-NER), которая специфически удаляет повреждения ДНК, которые блокируют РНК-полимеразу II (RNAPII), играет критическую роль в дестабилизации повторов [22], [23]. Недавнее биохимическое исследование бесклеточных экстрактов подтвердило наши генетические наблюдения, показав, что повторяющиеся шпильки на транскрибируемых или нетранскрибируемых цепях могут блокировать RNAPII [24]. Интересно, что шпильки сами по себе не задерживают чистую T7 RNAP, но требуют дополнительных компонентов в ядерном экстракте [24].Комплекс распознавания mismatch repair (MMR) MSh3 / MSh4 является сильным кандидатом на эту активность, потому что он связывается со шпильками CAG и CTG [25], [26], играет решающую роль в нестабильности повторов CAG у мышей [27], [28] ], [29], [30], и способствует индуцированной транскрипцией нестабильности повторов в клетках человека [18], [31]. Кроме того, мы идентифицировали другие модуляторы транскрипционно-зависимой нестабильности повторов в клетках человека, которые также могут вносить свой вклад, в том числе гибриды РНК / ДНК (R-петли) [32], протеасомный аппарат [23] и репарацию одноцепочечных разрывов. (SSBR) путь [33].Эти исследования показывают, что нестабильность CAG-повторов, вызванная транскрипцией, является результатом сложного молекулярного процесса.

Чтобы усугубить эту сложность, две недавние статьи сообщили, что одновременная смысловая и антисмысловая транскрипция — конвергентная транскрипция — через тракт CAG дестабилизирует повторы в клетках человека [34], [35], с более значительными эффектами, чем сумма смысловой и антисмысловой транскрипции. в одиночку [35]. Механизм нестабильности повторов, индуцированной конвергентной транскрипцией, не охарактеризован, но он, вероятно, может включать те же процессы ДНК, что и смысловая транскрипция.Однако конвергентная транскрипция не только способствует нестабильности повторов, но также запускает остановку клеточного цикла и массовую апоптоз-зависимую гибель клеток через ответ, подобный повреждению ДНК, с участием пути ATR и его последующих мишеней, таких как киназа 1 контрольной точки клеточного цикла (CHK1 ) и p53 [35]. В этом исследовании мы использовали нокдаун siRNA для определения роли компонентов репарации ДНК в конвергентной индуцированной транскрипцией повторяющейся нестабильности и гибели клеток. Мы обнаружили, что истощение MSh3 снижает повторяющуюся нестабильность и гибель клеток, в то время как истощение РНКазы H увеличивает как нестабильность, так и гибель.Напротив, истощение XPA снижает нестабильность, но увеличивает гибель клеток. Обсуждаются возможные роли этих белков в конвергентной индуцированной транскрипцией гибели клеток и нестабильности повторов.

Материалы и методы

Клеточные линии и культура клеток

Конструирование клеток DIT7 было описано ранее [35]. Вкратце, клетки RS11 экспрессируют белок rtTA, слияние белка-репрессора обратного тетрациклина и домена активации транскрипции VP16 HSV, который управляет экспрессией промотора pTRE-CMV mini в присутствии индуктора, доксициклина.Клетки RS11 также содержат гены RheoReceptor-1 и RheoActivator, которые управляют экспрессией промотора pNERB-X1 в присутствии индуктора RSL1. Клетки DIT7 были получены из клеток RS11 путем интеграции одной копии минигена HPRT , несущего тракт CAG 95 в своем интроне, со смысловой и антисмысловой транскрипцией, контролируемой промоторами pTRE-CMV mini и pNERB-X1, соответственно (рисунок 1). Смысловая транскрипция минигена HPRT в клетках DIT7 индуцируется в 22 раза доксициклином, а антисмысловая транскрипция индуцируется в 16 раз при помощи RSL1 [35].Клетки DIT7-R103 были получены из DIT7 путем сокращения повторяющегося тракта CAG с 95 до 15 единиц [35]. Клетки DIT7 и DIT7-R103 выращивали при 37 ° C с 5% CO 2 в среде DMEM / F-12 с добавлением 10% фетальной бычьей сыворотки и 1% заменимых аминокислот MEM.

Рисунок 1. Структура минигенов HPRT в клетках DIT7 и DIT7-R103.

Клетки DIT7 несут участок повтора CAG 95 , а клетки DIT7-R103, которые были получены из клеток DIT7 путем сокращения повтора, несут участок повтора CAG 15 .В обеих клеточных линиях тракт CAG центрирован в интроне размером 2,1 т.п.н. в единственном, случайно интегрированном минигене HPRT . Повтор CAG находится примерно на 1,6 т.п.н. ниже смыслового промотора и примерно на 2,5 т.п.н. выше антисмыслового промотора.

https://doi.org/10.1371/journal.pone.0046807.g001

Индукция транскрипции

Клетки выращивали и поддерживали в отсутствие индукторов транскрипции. Во всех экспериментах транскрипцию индуцировали добавлением индукторов в день 0.Смысловая транскрипция минигена HPRT была индуцирована добавлением доксициклина в конечной концентрации 0,2 мкг / мл. Поскольку период полужизни доксициклина в среде составляет около 24 часов, 0,1 мкг / мл доксициклина добавляли в среду каждый день до завершения лечения. Антисмысловую транскрипцию индуцировали добавлением RSL1 в конечной концентрации 500 нМ. Дополнительного RSL1 не требовалось.

Лечение миРНК

Около 100000 клеток высевали в каждую лунку 6-луночного планшета на день -3.На -2 день клетки трансфицировали индивидуальными миРНК до конечной концентрации 200 нМ, используя олигофектамин (Invitrogen). Обработки 200 нМ миРНК виментина служили контролем. Обработка siRNA виментина не влияет на клетки; он не изменяет процент клеток DIT7 и DIT7-R103, которые погибают при индуцировании конвергентной транскрипции. В день 0 клетки снова трансфицировали siRNA, и затем культуры выращивали в присутствии или в отсутствие доксициклина плюс RSL1. Эффективность нокдауна генов-мишеней определяли на +1 день для индивидуальных миРНК с использованием ОТ-ПЦР в реальном времени, как описано ранее [23], [32].Все siRNA, использованные в этом исследовании, снижали эффективность экспрессии целевого гена как минимум на 70%. Разные миРНК, которые нацелены на разные области одного и того же гена, помечены -1 и -2; например, XPA-1 и XPA-2 указывают на две разные миРНК против гена XPA. Последовательности этих миРНК и праймеров ОТ-ПЦР идентичны тем, которые использовались ранее [23], [32].

Измерения мертвых и жизнеспособных клеток

Мы определяем прикрепленные клетки (прикрепленные к планшету) как жизнеспособные клетки, а неприлипающие клетки (присутствующие в среде) как мертвые клетки [35].Ранее мы показали, что менее 4% прикрепленных клеток содержали йодид пропидия, что указывает на то, что более 96% прикрепленных клеток являются жизнеспособными [35]. Напротив, более 99% неприлипающих клеток окрашивались йодидом пропидия. Небольшое загрязнение неприлипающих клеток живыми клетками (и прикрепленных клеток мертвыми клетками) игнорировалось во всех экспериментах.

После второй трансфекции миРНК в день 0 клетки выращивали в присутствии или в отсутствие доксициклина и RSL1 в течение 4 дней, в это время определяли жизнеспособные (прикрепленные) и мертвые (неприлипающие) клетки.Количество мертвых клеток измеряли путем подсчета нескольких тысяч неприлипающих клеток в среде с использованием счетчика клеток Коултера. Таким же образом подсчитывали количество жизнеспособных клеток после отделения прикрепленных клеток от чашки обработкой трипсином. Процент мертвых клеток рассчитывали как количество неприлипающих клеток, деленное на общее количество прикрепленных плюс неприлипающих клеток. Каждый анализ состоит из результатов для одной лунки в шестилуночном планшете, который на момент анализа обычно содержит от 0,5 до 1 миллиона клеток.Для каждого эксперимента по нокдауну siRNA проводили по меньшей мере 6 независимых анализов, результаты усредняли и определяли стандартные отклонения.

Анализ сокращения

Как описано ранее, клетки DIT7, используемые в анализе сокращения, несут интегрированную копию минигена HPRT , экспрессия которого находится под контролем промотора Tet-ON [35]. Повтор CAG 95 , расположенный в интроне, инактивирует миниген, вызывая аберрантный сплайсинг мРНК, делая белок нефункциональным.Сокращение повтора до менее чем 39 единиц позволяет достаточно правильное сращивание, чтобы обеспечить нормальную функцию HPRT. Этот тест отбора измеряет сокращение от 56 до 95 повторяющихся единиц. В тексте мы называем эти события, в частности, повторяющимися сокращениями и в целом повторяющейся нестабильностью.

Для анализов сокращения после второй трансфекции siRNA в день 0 клетки DIT7 выращивали в присутствии или в отсутствие доксициклина и RSL1 в течение 2 дней. Затем клетки повторно подпитывали свежей средой без индукторов и давали им возможность восстановиться в течение одного дня.На 3-й день клетки высевали в селективную среду HAT (0,1 мМ гипоксантин, 0,4 мкМ аминоптерин и 16 мкМ тимин) с добавлением доксициклина при плотности клеток 500000 клеток на 10-см чашку и позволяли образовывать колонии. Частоту сокращений рассчитывали как количество колоний HPRT + , деленное на количество жизнеспособных клеток; это среднее значение минимум 6 экспериментов.

Связывание in vitro и вестерн-блоттинг

Для тестирования связывания in vitro мы сконструировали следующие 4 олигонуклеотида ДНК: 13-4 CGGCGCTGGGCGCGCACCGAG (CAG) 13 GATCCTCGAGCTGGTCCCGCAGGC; 13-5 CGGCGCTGGGCGCGCACCGAG (CTG) 13 GATCCTCGAGCTGGTCCCGCAGGC; 13-7 CGGCGCTGGGCGCGCACCGAGGATCCTCGAGCTGGTCCCGCAGGC; и 13-6bait GCCTGCGGGACCAGCTCGAGGATCCTGCTCGGTGCGCGCCCAGCGCCG-Bio.Отжиг 13-6 приманки с 13-4, 13-5 или 13-7 при молярном соотношении 1-4 образует двухцепочечные фрагменты ДНК, которые содержат шпильку CAG 13 , шпильку CTG 13 или не шпильку, соответственно. . Эти пары олигонуклеотидов ДНК инкубировали с магнитными частицами стрептавидина (Roche) при комнатной температуре в течение 30 мин при осторожном встряхивании. Гранулы дважды промывали промывочным буфером (10 мМ Трис-HCl, 1 мМ EDTA, 100 мМ NaCl, pH 7,5), дважды PBS, содержащим 1% NP-40, а затем ресуспендировали в 400 мкл PBS, содержащем 1% NP-40. .Добавляли 600 мкл 10% молока и раствор осторожно встряхивали при комнатной температуре в течение 2 часов. Затем шарики промывали четыре раза PBS, содержащим 0,5% NP-40. Для связывания шарики ресуспендировали в 400 мкл PBS с 1% NP-40, добавляли около 150 мкг экстракта цельных клеток и смесь осторожно встряхивали в течение 2 часов при комнатной температуре. Гранулы промывали 4 раза ресуспендированием в PBS, содержащем 0,5% NP-40, с последующим центрифугированием при 3000 об / мин в течение 1 минуты. Белки, связанные с шариками, элюировали добавлением 60 мкл загрузочного буфера вестерн-блоттинга (50 мМ Трис, pH 6.8, 100 мМ DTT, 2% SDS, 0,1% бромфенолового синего, 10% глицерина) с последующим коротким встряхиванием, инкубировали при 95 ° C в течение 5 минут, а затем центрифугировали при 8000 об / мин в течение 1 минуты. Супернатант осторожно удаляли для вестерн-блоттинга. 10 мкл супернатанта загружали в каждую дорожку гелей 10% SDS / PAGE, а 5 мкг экстракта цельных клеток загружали в соседнюю дорожку, чтобы служить в качестве эталона. После того, как гели подвергали электрофорезу, белки переносили на поливинилидендифторидные мембраны и инкубировали с антителами против XPA (Santa Cruz) или актина (Sigma).Затем иммуноблоты визуализировали с использованием расширенного набора ECL (GE Healthcare).

Статистика

Статистический анализ значимости был проведен с использованием теста Стьюдента t для сравнения средних значений и стандартных отклонений, которые были получены в результате нескольких экспериментов.

Результаты

TC-NER защищает от гибели клеток, индуцированной конвергентной транскрипцией

Мы предполагали ранее, что остановка RNAPII на повторах CAG во время конвергентной транскрипции запускает клеточную стрессовую реакцию, которая ведет к гибели клеток [35], [36].Поскольку функция TC-NER заключается в удалении шпилек, которые останавливают RNAPII, мы ожидали, что снижение эффективности TC-NER приведет к более стойкому задержанию RNAPII и усугубит гибель клеток, вызванную конвергентной транскрипцией.

Чтобы проверить роль TC-NER в гибели клеток, индуцированной конвергентной транскрипцией, мы отключили четыре компонента NER с помощью специфических siRNA и измерили частоту гибели клеток в клетках DIT7 и DIT7-R103, каждая из которых содержит встроенный HPRT миниген, который несет повторяющиеся участки CAG 95 и CAG 15 , соответственно (Рисунок 1).Поскольку клетки DIT7-R103 были получены из клеток DIT7 путем сокращения повтора CAG, они различаются только длиной тракта повтора [35]. Как было показано ранее, эти две клеточные линии различаются по своей чувствительности к конвергентной транскрипции, при этом клетки DIT7 умирают примерно в два раза быстрее, чем клетки DIT7-R103, когда индуцируется конвергентная транскрипция [35]. Факторы NER XPA, ERCC1 и XPG и TC-NER-специфический фактор CSB необходимы для индуцированной транскрипцией нестабильности CAG [18], [23]. Обработка миРНК, использованная в этом исследовании, снижает их целевые уровни на 70–90% в человеческих клетках HT1080 [18], [23], [32].Нокдаун siRNA XPA, CSB, ERCC1 или XPG значительно увеличивал гибель клеток как в DIT7, так и в DIT7-R103 клетках (рис. 2). Эти результаты предполагают, что путь TC-NER обычно функционирует для защиты клеток от конвергентной индуцированной транскрипцией гибели клеток, вероятно, путем снятия блока с арестованных комплексов RNAPII, которые являются начальными триггерами ответа клетки на стресс [36].

Рис. 2. Влияние нокдауна компонентов TC-NER на конвергентную гибель клеток, вызванную транскрипцией.

(A) siRNA нокдаунов в клетках DIT7.Частоты гибели клеток: виментин — 47%; XPA-1, 55%; XPA-2, 63%; ЦСУ-1, 52%; ЦСУ-2, 51%; ERCC1-1, 61%; ERCC1-2, 53%; XPG-1, 51%; XPG-2, 57%. (B) нокдауны миРНК в клетках DIT7-R103. Частоты гибели клеток: виментин — 22%; XPA-1, 33%; XPA-2, 31%; ЦСУ-1, 29%; ЦСУ-2, 26%; ERCC1-1, 39%; ERCC1-2, 31%; XPG-1, 25%; XPG-2, 40%. Частоту гибели клеток рассчитывали как количество неприлипающих клеток, деленное на сумму прикрепленных и неприлипающих клеток. Данные представляют собой среднюю частоту гибели клеток по меньшей мере из 6 независимых экспериментов по нокдауну siRNA.Планки погрешностей указывают стандартные отклонения. Показана статистическая значимость относительно контроля виментина: * P <0,05; ** P <0,001; *** P <0,0001.

https://doi.org/10.1371/journal.pone.0046807.g002

Когда данные на рисунке 2 нормализованы к контролю siRNA виментина для каждой клеточной линии, становится очевидным, что нокдаун компонентов TC-NER имеет большее значение. влияние на гибель клеток в клетках DIT7-R103 (CAG 15 ), чем в клетках DIT7 (CAG 95 ) (Таблица 1).Таким образом, линия клеток с более коротким трактом CAG, по-видимому, более чувствительна к снижению емкости TC-NER, чем линия с более длинным повтором.

XPA связывается со шпильками

in vitro

Поскольку TC-NER помогает решить проблемы, вызванные конвергентной транскрипцией, мы стремились определить, может ли ключевой компонент, XPA, связываться с повторяющимися шпильками. Известно, что XPA связывается со спиральными перегибами, которые могут способствовать тому, как клетка выбирает соответствующий путь репарации ДНК [37]. Кроме того, UvrA, компонент эксцизионной репарации нуклеотидов в E.coli, как было показано, связывается со шпильками CAG in vitro [38]. Чтобы проверить, задействован ли XPA в шпильках, мы отожгли олигонуклеотиды ДНК для образования дуплекса без шпильки, дуплекса с шпилькой CAG или одного с шпилькой CTG, а затем инкубировали их в ядерном экстракте в качестве связывающих приманок. Затем мы выполнили анализ с использованием XPA-специфических антител. Как показано на рисунке 3, XPA связывается с шпильками CAG и CTG с аналогичной эффективностью, но не связывается с дуплексной ДНК. Эти результаты показывают, что XPA, вероятно, является одним из белков, связанных с повторяющимися шпильками тракта в клетках.Поскольку мы использовали ядерный экстракт в качестве источника белка, наши результаты не различают связывание XPA непосредственно со шпильками или через ассоциацию с другими белками.

Рисунок 3. Связывание XPA с дуплексами ДНК, содержащими CAG и CTG.

Дуплексы без шпилек, со шпилькой CAG 13 или шпилькой CTG 13 прикрепляли к магнитным шарикам (см. Методы) и инкубировали с экстрактом целых клеток из клеток человека. Белки, связанные с ДНК, затем анализировали вестерн-блоттингом с использованием антител против актина или XPA.Актин служил контролем для неспецифического связывания. WCE означает экстракт цельных клеток.

https://doi.org/10.1371/journal.pone.0046807.g003

MSh3 способствует гибели клеток, индуцированной конвергентной транскрипцией

Комплекс распознавания MMR MSh3 / MSh4 (MutSβ), который связывается со шпильками CAG и CTG in vitro [25], [26], является вероятным кандидатом на роль клеточного компонента, который стабилизирует повторяющиеся структуры и создает препятствия для RNAPII [24], [35]. Если остановка RNAPII является важным элементом сигнала для конвергентной индуцированной транскрипцией гибели клеток, то мы могли бы ожидать, что истощение MSh3 / MSh4 должно уменьшать гибель клеток.Чтобы проверить эту идею, мы использовали миРНК для подавления MSh3 в клетках DIT7 и DIT7-R103. Как показано на фиг. 4, обработка двумя миРНК MSh3 значительно снижала гибель обеих клеточных линий. Как и в случае нокдауна компонентов TC-NER, нормализованный эффект нокдауна MSh3 на гибель клеток был больше в клетках DIT7-R103 (CAG 15 ), чем в клетках DIT7 (CAG 15 ) (таблица 1).

Рисунок 4. Эффекты нокдауна MSh3 на конвергентную транскрипционную гибель клеток.

(A) siRNA нокдаунов в клетках DIT7.Частоты гибели клеток: виментин — 47%; МШ3-1, 41%; МШ3-2, 42%. (B) нокдауны миРНК в клетках DIT7-R103. Частоты гибели клеток: виментин — 22%; МШ3-1,4%; МШ3-2,9%. Частоту гибели клеток рассчитывали как количество неприлипающих клеток, деленное на сумму прикрепленных и неприлипающих клеток. Данные представляют собой среднюю частоту гибели клеток по меньшей мере из 6 независимых экспериментов по нокдауну siRNA. Планки погрешностей указывают стандартные отклонения. Показана статистическая значимость относительно контроля виментина: * P <0.05; ** P <0,001; *** P <0,0001.

https://doi.org/10.1371/journal.pone.0046807.g004

Ферменты РНКазы H снижают гибель клеток, индуцированную конвергентной транскрипцией

Ранее мы показали, что обширные гибриды РНК / ДНК (R-петли) образуются во время смысловой транскрипции участков повторов CAG в клетках человека [32]. Ферменты РНКазы Н обычно удаляют РНК-компонент R-петель для устранения гибридов. Истощение РНКазы h2 или РНКазы h3A, которое продлит время жизни R-петель, увеличивает индуцированную транскрипцией нестабильность CAG в клетках человека [32], предполагая, что R-петли способствуют нестабильности повторов.Ранее мы предполагали, что R-петли могут усиливать образование шпилек в нетемплатной цепи [23], [32]. Поскольку шпильки блокируют RNAPII, мы ожидали, что истощение RNase h2 и RNase h3A будет увеличивать образование шпильки и задержку RNAPII и, таким образом, увеличивать гибель клеток. Чтобы проверить, может ли истощение ферментов РНКазы Н увеличивать гибель клеток, мы использовали миРНК для нокдауна РНКазы h2 и РНКазы h3A. Нокдаун либо РНКазы h2, либо только РНКазы 2A не оказывал существенного влияния на гибель клеток в клетках DIT7 или в клетках DIT7-R103; однако их двойной нокдаун значительно увеличил гибель клеток в обеих клеточных линиях (рис. 5).И снова нормализованный эффект двойного нокдауна на гибель клеток был больше в клетках DIT7-R103 (CAG 15 ), чем в клетках DIT7 (CAG 95 ) (таблица 1).

Рис. 5. Эффекты нокдауна РНКазы H на гибель клеток, индуцированную конвергентной транскрипцией.

(A) siRNA нокдаунов в клетках DIT7. Частоты гибели клеток: виментин — 47%; РНКаза h2-1, 49%; РНКаза h3A-1, 46%; РНКаза h2-1 плюс РНКаза h3A-1, 54%. (B) нокдауны миРНК в клетках DIT7-R103. Частоты гибели клеток: виментин — 22%; РНКаза h2-1, 27%; РНКаза h3A-1, 28%; РНКаза h2-1 плюс РНКаза h3A-1, 44%.Частоту гибели клеток рассчитывали как количество неприлипающих клеток, деленное на сумму прикрепленных и неприлипающих клеток. Данные представляют собой среднюю частоту гибели клеток по меньшей мере из 6 независимых экспериментов по нокдауну siRNA. Планки погрешностей указывают стандартные отклонения. Показана статистическая значимость относительно контроля виментина: * P <0,05; ** P <0,001; *** P <0,0001.

https://doi.org/10.1371/journal.pone.0046807.g005

MSh3, XPA и РНКаза H модулируют сокращение повторения, индуцированное конвергентной транскрипцией

В клетках человека как TC-NER, так и распознавание ошибочного спаривания с помощью MSh3 / MSh4 необходимы для сокращения повтора, вызванного смысловой транскрипцией через тракт повтора, поскольку нокдаун любого из отдельных компонентов снижает частоту индуцированного транскрипцией сокращения повтора CAG [18 ]. Напротив, РНКаза H, благодаря своей способности устранять R-петли, помогает предотвратить индуцированное транскрипцией сокращение повторов [32].Поскольку конвергентная транскрипция синергетически стимулирует нестабильность повтора по сравнению с одной только смысловой или антисмысловой транскрипцией [35], было неясно, будут ли TC-NER, распознавание ошибочного спаривания и R-петли иметь такой же эффект на сокращение повторов, вызванное конвергентной транскрипцией, как на нестабильность, вызванная смысловой транскрипцией. Чтобы проверить эти процессы, мы измерили частоты сокращений CAG в клетках DIT7 (CAG 95 ) после нокдауна ферментов XPA, MSh3 или РНКазы H в клетках, индуцированных для конвергентной транскрипции.Как показано на фиг. 6, нокдаун XPA или MSh3 значительно снижает частоту сокращений, в то время как одновременный нокдаун РНКазы h2 и РНКазы h3A значительно увеличивает частоту сокращений. Эти результаты предполагают, что нестабильность повторов, индуцированная конвергентной транскрипцией, подобная той, которая индуцируется одной только смысловой транскрипцией, также зависит от TC-NER и распознавания ошибочного спаривания и усиливается R-петлями.

Рисунок 6. Влияние нокдаунов MSh3, XPA и РНКазы H на сокращение CAG-повторов, индуцированное конвергентной транскрипцией.

Частоты сокращений рассчитывали как количество колоний HPRT + , деленное на количество жизнеспособных клеток, усредненное по меньшей мере по 6 независимым экспериментам по нокдауну siRNA. Планки погрешностей указывают стандартные отклонения. Показана статистическая значимость относительно контроля виментина: * P <0,05; ** P <0,01.

https://doi.org/10.1371/journal.pone.0046807.g006

Обсуждение

Антисмысловые транскрипты распространены в генах человека [39], что позволяет предположить, что прямая конвергентная транскрипция может быть частым явлением в хромосомах человека.Антисмысловые транскрипты были обнаружены в нескольких генах болезни с тринуклеотидными повторами (TNR), 8 из которых идентифицированы in vivo [17], [40], [41], [42], [43], [44], [45], [46] ] и по крайней мере 10 других в линиях клеток человека [47]. Ранее мы исследовали биологические последствия конвергентной транскрипции через тракт CAG, показав, что она способствует нестабильности повторов и вызывает массовую гибель клеток [35]. Здесь мы исследовали влияние трех метаболических процессов ДНК на гибель клеток, индуцированную конвергентной транскрипцией, и повторяющуюся нестабильность.Путь репарации ДНК TC-NER, компонент распознавания репарации ошибочного спаривания MSh3 и виды РНКазы H, участвующие в разрешении R-петли, которые были впервые идентифицированы как играющие критическую роль в нестабильности повторов, вызванной смысловой транскрипцией [18], [23] , [32], все влияют на нестабильность повторов и гибель клеток, вызванные конвергентной транскрипцией. Эти результаты предполагают, что общая структура, генерируемая конвергентной транскрипцией через тракт повторов CAG, вероятно, в конечном итоге ответственна как за нестабильность повторов, так и за гибель клеток.

Что касается индуцированной смысловой транскрипцией нестабильности повторов, мы предположили, что транскрипция позволяет проскользнувшим дуплексам образовываться с выведенными петлей CAG и CTG сегментами [22], [23], и что R-петли усиливают образование этих аберрантных структур [32]. Стабилизация петель CAG и CTG связыванием MSh3 / MSh4 (MutSβ) может блокировать продвижение RNAPII [24], [25], тем самым создавая сигнал, который вызвал TC-NER в игру для разрешения блока [22], [24] , [48]. Эта рабочая модель была создана, чтобы соответствовать результатам нокдаунов siRNA.Истощение RNase H, которое д. Увеличивать время жизни R-петель, должно было бы увеличивать образование скользящих дуплексов, приводя к большей повторяющейся нестабильности, как наблюдалось [32]. Нокдаун MSh3, который д. Снижать связывание и стабилизацию петель CAG и CTG, д. Уменьшать остановку RNAPII, приводя к наблюдаемому снижению нестабильности повторов [18]. Сбивание компонентов TC-NER предотвращает разрешение блока, что является механизмом, с помощью которого повтор становится нестабильным, и, таким образом, снижает нестабильность повторения [23].Здесь мы показали, что то же самое рассуждение применимо к конвергентной индуцированной транскрипцией нестабильности повторов.

Мы предположили в другом месте [35], что конвергентная транскрипция через повторяющийся тракт может генерировать аберрантные структуры с остановившимися комплексами RNAPII на обеих цепях, создавая то, что мы назвали двойным пузырем [36]. Поскольку структуры на каждой цепи аналогичны структуре, описанной выше для смысловой транскрипции, мы ожидали, что нокдаун РНКазы H, MSh3 и TC-NER будет производить такие же эффекты на нестабильность повтора, вызванную конвергентной транскрипцией, как и на повторе нестабильность, вызванная смысловой транскрипцией.Наши результаты соответствуют этим ожиданиям: истощение РНКазы H увеличивает нестабильность, а истощение MSh3 и TC-NER снижает повторяющуюся нестабильность.

Более удивительный результат конвергентной транскрипции через тракт повторов CAG — массовая гибель клеток — зависит от одновременной индукции как смысловой, так и антисмысловой транскрипции с обеих сторон тракта повторов CAG, так что конвергентные комплексы RNAPII встречаются с одним и тем же трактом [35]. Образующийся в результате двойной пузырек, продуцируемый остановившимися комплексами RNAPII на обеих цепях, должен представлять серьезное осложнение для клетки, которое вызывает ответ ATR и запускает гибель клетки — два последствия, которые не связаны только с смысловой транскрипцией [35], [36]. .Вначале было неясно, будут ли процессы, вовлеченные в конвергентную индуцированную транскрипцией повторяющуюся нестабильность, также участвовать в ассоциированной гибели клеток. Однако наши нокдаун-эксперименты ясно показывают, что РНКаза H, MSh3 и TC-NER участвуют как в повторяющейся нестабильности, так и в гибели клеток. Мы можем интерпретировать наши результаты с точки зрения вероятных эффектов на формирование или сохранение конвергентного двойного пузыря, индуцированного транскрипцией. Нокдаун РНКазы H увеличивает количество R-петель, что способствует образованию сдвинутых дуплексов, которые являются ключевыми для образования двойных пузырьков, тем самым увеличивая формирование структуры и увеличивая гибель клеток.Нокдаун MSh3 предотвращает стабилизацию петель CAG и CTG, тем самым уменьшая образование структуры и гибель клеток. Точно так же нокдаун MSh4 также снижает гибель клеток, в то время как двойной нокдаун MSh3 и MSh4 снижает гибель клеток до того же уровня, что и один нокдаун (данные не показаны), что согласуется с MutSβ, играющим роль в стабилизации петель CAG и CTG [25 ], [26]. Наконец, истощение компонентов TC-NER предотвращает разрешение блока до RNAPII, продлевая аберрантную структуру и увеличивая гибель клеток.

Одна поразительная особенность воздействия нокдаунов siRNA на гибель клеток заключается в том, что клетки DIT7-R103, которые несут короткий повтор (CAG 15 ), поражаются сильнее, чем клетки DIT7, которые несут длинный повтор (CAG 95 ). ). Этот противоречивый результат не может быть связан с различным расположением повтора в геноме, например, потому что клетки DIT7-R103 были получены из клеток DIT7 путем сокращения повтора. Хотя мы не знаем, в чем состоит разница, мы предполагаем, что она отражает различное количество петель CAG и CTG, которые могут образовываться в двух повторах.Длинный тракт CAG потенциально может образовывать множественные петли, что согласуется с нашими измерениями одноцепочечных регионов внутри тракта [32], тогда как короткий тракт вряд ли образует более одного. Уменьшение MSh3, например, уменьшило бы количество стабилизированных петель в тракте. Однако, если в тракте имеется несколько петель, некоторые из них все же могут стабилизироваться, что оказывает небольшое влияние на гибель клеток. Напротив, в тракте с единственной петлей уменьшение MSh3 привело бы к уменьшению количества клеток, в которых петля стабилизируется, тем самым уменьшая гибель клеток.Аналогичные аргументы можно привести в пользу эффектов нокдаунов РНКазы H и TC-NER, которые, как ожидается, увеличат количество стабилизированных петель. Если клетки с длинными повторами уже имеют несколько стабилизированных петель, увеличение может иметь незначительное влияние на гибель клеток, тогда как в клетках с одним повтором нокдауны могут увеличить долю клеток со стабилизированной петлей, что приведет к более значительному увеличению гибели клеток.

Наши результаты согласуются с идеей, что застопорившаяся RNAPII является исходным сигналом, запускающим гибель клеток во время конвергентной транскрипции [17].Предыдущие исследования показали, что такие агенты, как ультрафиолетовый свет, актиномицин D, псорален или антитела против комплекса элонгации RNAPII — все они мешают транскрипции, блокируя RNAPII на всем геноме — могут стимулировать апоптоз [49], [50], [51], [52]. Как общегеномная остановка RNAPII, так и его остановка на участках CAG стимулируют клеточный ответ через сигнальный путь ATR [35], [49]. Примечательно, что RNAPII, арестованный в одном локусе генома, оказывает на клетки такое же действие, как транскрипционная интерференция в масштабе всего генома, которая возникает в тысячах активно транскрибируемых генов.Важнейшей особенностью этого локуса, по-видимому, является способность повторов CAG образовывать аномальные вторичные структуры, способные блокировать транскрипцию на обеих цепях матрицы. Пока не ясно, является ли гибель клеток, индуцированная конвергентной транскрипцией, уникальной для CAG-повторов, или также является более общим признаком других структурообразующих повторов. Эту возможность подтверждает наблюдение, что транскрипция останавливается на других типах повторяющихся участков и на последовательностях ДНК, которые могут формировать вторичные структуры in vitro [53], [54], [55], [56], [57]; таким образом, неканонические структуры ДНК могут создавать проблемы для РНКП.

Патогенетические механизмы заболеваний CAG сложны и, по-видимому, включают токсичные белки и молекулы РНК [2], [36], [58], [59]. Конвергентная гибель клеток, вызванная транскрипцией, повышает вероятность того, что токсичность ДНК также может вносить вклад в патогенез этих заболеваний. Ранее мы показали, что конвергентная транскрипция посредством повторов CAG может запускать гибель клеток как в пролиферирующих, так и в непролиферирующих клетках [35], указывая на то, что это потенциальный механизм гибели клеток в терминально дифференцированных клетках, которые поражаются при повторных заболеваниях.Кроме того, антисмысловые транскрипты были обнаружены для нескольких генов болезни TNR, что подтверждает идею о том, что конвергентная транскрипция происходит in vivo и потенциально может влиять на здоровье клеток. Однако вклад конвергентной транскрипции в патогенез повторяющихся заболеваний еще предстоит проверить.

Таким образом, мы показали, что путь TC-NER, MSh3 и R-петли модулируют индуцированную конвергентной транскрипцией повторяющуюся нестабильность и гибель клеток в клетках человека. Эти наблюдения связывают механизмы индуцируемой конвергентной транскрипцией повторяющейся нестабильности и индуцированной конвергентной транскрипцией гибели клеток, предполагая, что общая структура может запускать оба исхода.

Благодарности

Мы благодарим сотрудников лаборатории Вильсона за полезные обсуждения.

Вклад авторов

Задумал и спроектировал эксперименты: YL JHW. Проведены эксперименты: YL. Проанализированы данные: YL JHW. Написал статью: YL JHW.

Список литературы

  1. 1. Вентер Дж. К., Адамс, доктор медицины, Майерс Э. У., Ли П. У., Фреска Р. Дж. И др. (2001) Последовательность генома человека. Наука 291: 1304–1351.
  2. 2. La Spada AR, Taylor JP (2010) Болезнь повторного распространения: прогресс и загадки в патогенезе болезни.Нат Рев Генет 11: 247–258.
  3. 3. Orr HT, Zoghbi HY (2007) Расстройства тринуклеотидных повторов. Annu Rev Neurosci 30: 575–621.
  4. 4. Gatchel JR, Zoghbi HY (2005) Болезни нестабильной повторной экспансии: механизмы и общие принципы. Нат Рев Генет 6: 743–755.
  5. 5. Пирсон CE, Эдамура KN, Клири JD (2005) Повторная нестабильность: механизмы динамических мутаций. Нат Рев Генет 6: 729–742.
  6. 6. Waterland RA, Dolinoy DC, Lin JR, Smith CA, Shi X и др.(2006) Материнские метиловые добавки увеличивают метилирование ДНК потомства в Axin Fused. Бытие 44: 401–406.
  7. 7. Свами М., Хендрикс А.Е., Гиллис Т., Массуд Т., Майсор Дж. И др. (2009) Соматическое распространение CAG-повторов болезни Хантингтона в головном мозге связано с более ранним возрастом начала заболевания. Hum Mol Genet 18: 3039–3047.
  8. 8. Клири JD, Pearson CE (2003) Вклад цис-элементов в связанную с заболеванием повторяющуюся нестабильность: клинические и экспериментальные доказательства.Cytogenet Genome Res 100: 25–55.
  9. 9. Pelletier R, Farrell BT, Miret JJ, Lahue RS (2005) Механистические особенности сокращений повторов CAG * CTG в культивируемых клетках, выявленные с помощью нового генетического анализа. Nucleic Acids Res 33: 5667–5676.
  10. 10. Wells RD, Dere R, Hebert ML, Napierala M, Son LS (2005) Успехи в механизмах генетической нестабильности, связанные с наследственными неврологическими заболеваниями. Nucleic Acids Res 33: 3785–3798.
  11. 11. Миркин С.М. (2007) Расширяемые повторы ДНК и болезни человека.Природа 447: 932–940.
  12. 12. McMurray CT (2010) Механизмы нестабильности тринуклеотидных повторов в процессе развития человека. Нат Рев Генет 11: 786–799.
  13. 13. Райли Б.Е., Орр Х.Т. (2006) Полиглутаминовые нейродегенеративные заболевания и регуляция транскрипции: собирая головоломку. Genes Dev 20: 2183–2192.
  14. 14. Dion V, Lin Y, Hubert L Jr, Waterland RA, Wilson JH (2008) Дефицит Dnmt1 способствует расширению CAG-повторов в зародышевой линии мыши.Hum Mol Genet 17: 1306–1317.
  15. 15. Ковтун IV, Джонсон KO, McMurray CT (2011) Белок B синдрома Коккейна противодействует OGG1, модулируя длину повтора CAG in vivo. Старение (Олбани, штат Нью-Йорк) 3: 509–514.
  16. 16. Ковтун И.В., Лю Й., Бьорас М., Клунгланд А., Уилсон С.Х. и др. (2007) OGG1 инициирует возрастную экспансию тринуклеотидов CAG в соматических клетках. Природа 447: 447–452.
  17. 17. Hubert L Jr, Lin Y, Dion V, Wilson JH (2011) Дефицит Xpa снижает нестабильность тринуклеотидного повтора CAG в нейрональных тканях в мышиной модели SCA1.Hum Mol Genet 20: 4822–4830.
  18. 18. Lin Y, Dion V, Wilson JH (2006) Транскрипция способствует сокращению участков повторов CAG в клетках человека. Nat Struct Mol Biol 13: 179–180.
  19. 19. Jung J, Bonini N (2007) CREB-связывающий белок модулирует повторяющуюся нестабильность в модели болезни polyQ у дрозофилы. Science 315: 1857–1859.
  20. 20. Pearson CE, Sinden RR (1996) Альтернативные структуры в дуплексной ДНК, образованные внутри тринуклеотидных повторов миотонической дистрофии и ломких X-локусов.Биохимия 35: 5041–5053.
  21. 21. Gacy AM, Goellner G, Juranic N, Macura S, McMurray CT (1995) Тринуклеотидные повторы, которые расширяются при заболевании человека, образуют шпильки in vitro. Ячейка 81: 533–540.
  22. 22. Lin Y, Hubert L Jr, Wilson JH (2009) Транскрипция дестабилизирует триплетные повторы. Mol Carcinog 48: 350–361.
  23. 23. Lin Y, Wilson JH (2007) Вызванное транскрипцией сокращение CAG-повторов в клетках человека частично опосредуется транскрипционно-связанной эксцизионной репарацией нуклеотидов.Mol Cell Biol 27: 6209–6217.
  24. 24. Салинас-Риос V, Белоцерковский Б.П., Hanawalt PC (2011) Выскальзывания ДНК вызывают арест РНК-полимеразы II in vitro: потенциальные последствия для генетической нестабильности. Nucleic Acids Res 39: 7444–7454.
  25. 25. Owen BA, Yang Z, Lai M, Gajek M, Badger JD, 2nd, et al (2005) (CAG) (n) ДНК-шпилька волос связывается с Msh3-Msh4 и изменяет свойства распознавания несовпадений. Nat Struct Mol Biol 12: 663–670.
  26. 26. Pearson CE, Ewel A, Acharya S, Fishel RA, Sinden RR (1997) Человеческий MSh3 связывается со структурами ДНК с тринуклеотидными повторами, связанными с нейродегенеративными заболеваниями.Hum Mol Genet 6: 1117–1123.
  27. 27. Ковтун И. В., Мак-Мюррей СТ (2001) Экспансия тринуклеотида в гаплоидных зародышевых клетках путем репарации разрывов. Нат Генет 27: 407–411.
  28. 28. Manley K, Shirley TL, Flaherty L, Messer A (1999) Дефицит Msh3 предотвращает соматическую нестабильность in vivo CAG-повтора у трансгенных мышей с болезнью Хантингтона. Нат Генет 23: 471–473.
  29. 29. Савуре С., Бриссон Э., Эссерс Дж., Канаар Р., Пастинк А. и др. (2003) Нестабильность повтора CTG и время изменения размера у мышей с дефицитом репарации ДНК.Embo J 22: 2264–2273.
  30. 30. Савуре С., Гарсия-Кордье С., Мегрет Дж., Те Риле Х., Жуниен С. и др. (2004) MSh3-зависимые герминальные экспансии CTG-повторов непрерывно продуцируются в сперматогониях трансгенных мышей DM1. Mol Cell Biol 24: 629–637.
  31. 31. Lin Y, Wilson JH (2009) Разнообразные эффекты отдельных компонентов репарации несовпадений на индуцированную транскрипцией нестабильность повторов CAG в клетках человека. Ремонт ДНК (Amst) 8: 878–885.
  32. 32. Lin Y, Dent SY, Wilson JH, Wells RD, Napierala M (2010) R-петли стимулируют генетическую нестабильность CTG.CAG повторяется. Proc Natl Acad Sci U S A 107: 692–697.
  33. 33. Hubert L Jr, Lin Y, Dion V, Wilson JH (2011) Топоизомераза 1 и восстановление однонитевого разрыва модулируют индуцированное транскрипцией сокращение повторов CAG в клетках человека. Mol Cell Biol 31: 3105–3112.
  34. 34. Nakamori M, Pearson CE, Thornton CA (2011) Двунаправленная транскрипция стимулирует расширение и сокращение расширенных (CTG) * (CAG) повторов. Hum Mol Genet 20: 580–588.
  35. 35. Лин И, Ленг М., Ван М., Уилсон Дж. Х. (2010) Конвергентная транскрипция через длинный тракт CAG дестабилизирует повторы и индуцирует апоптоз.Mol Cell Biol 30: 4435–4451.
  36. 36. Lin Y, Wilson JH (2011) Вызванная транскрипцией токсичность ДНК в тринуклеотидных повторах: двойной пузырь — это проблема. Клеточный цикл 10: 611–618.
  37. 37. Camenisch U, Dip R, Schumacher SB, Schuler B, Naegeli H (2006) Распознавание спиральных изгибов белком группы A xeroderma pigmentosum запускает эксцизионную репарацию ДНК. Nat Struct Mol Biol 13: 278–284.
  38. 38. Уссачева Е.А., Хашем В.И., Зоу Й., Синден Р.Р., Потаман В.Н. (2001) Вовлечение белка эксцизионной репарации нуклеотидов UvrA в нестабильность последовательностей повторов CAG * CTG в Escherichia coli.J Biol Chem 276: 30878–30884.
  39. 39. Катаяма С., Томару Ю., Касукава Т., Ваки К., Наканиши М. и др. (2005) Антисмысловая транскрипция в транскриптоме млекопитающих. Наука 309: 1564–1566.
  40. 40. Уилберн Б., Рудницки Д.Д., Чжао Дж., Вейц Т.М., Ченг Й. и др. (2011) Антисмысловой транскрипт повтора CAG в локусе JPh4 опосредует повышенную токсичность полиглутаминового белка у мышей, подобных болезни Гентингтона 2. Нейрон 70: 427–440.
  41. 41. Мозли М.Л., Зу Т., Икеда Й., Гао В., Мосемиллер А.К. и др.(2006) Двунаправленная экспрессия транскриптов экспансии CUG и CAG и внутриядерных включений полиглутамина при спиноцеребеллярной атаксии 8 типа. Nat Genet 38: 758–769.
  42. 42. Ladd PD, Smith LE, Rabaia NA, Moore JM, Georges SA и др. (2007) Антисмысловой транскрипт, охватывающий область повтора CGG FMR1, активируется у носителей премутации, но заглушается у индивидов с полной мутацией. Hum Mol Genet 16: 3174–3187.
  43. 43. Чо Д.Х., Тиен С.П., Махони С.Е., Аналау Э., Филиппова Г.Н. и др.(2005) Антисмысловая транскрипция и гетерохроматин в повторах CTG DM1 ограничиваются CTCF. Mol Cell 20: 483–489.
  44. 44. Chung DW, Rudnicki DD, Yu L, Margolis RL (2011) Природный антисмысловой транскрипт в локусе повторов болезни Хантингтона регулирует экспрессию HTT. Hum Mol Genet 20: 3467–3477.
  45. 45. De Biase I, Chutake YK, Rindler PM, Bidichandani SI (2009) Эпигенетическое молчание при атаксии Фридрейха связано с истощением CTCF (фактора связывания CCCTC) и антисмысловой транскрипцией.PLoS One 4: e7914.
  46. 46. Софер Б.Л., Лэдд П.Д., Пинеда В.В., Либби Р.Т., Санкин С.М. и др. (2011) CTCF регулирует экспрессию атаксина-7 посредством промотирования конвергентно транскрибируемой антисмысловой некодирующей РНК. Нейрон 70: 1071–1084.
  47. 47. He Y, Vogelstein B, Velculescu VE, Papadopoulos N, Kinzler KW (2008) Антисмысловые транскриптомы человеческих клеток. Наука 322: 1855–1857.
  48. 48. Ким Н., Джинкс-Робертсон С. (2012) Транскрипция как источник нестабильности генома.Нат Рев Генет 13: 204–214.
  49. 49. Дерхеймер Ф.А., О’Хаган Х.М., Крюгер Х.М., Ханасоге С., Полсен М.Т. и др. (2007) RPA и ATR связывают стресс транскрипции с p53. Proc Natl Acad Sci U S A 104: 12778–12783.
  50. 50. Ljungman M (2007) Ответ на стресс транскрипции. Клеточный цикл 6: 2252–2257.
  51. 51. Ljungman M, Lane DP (2004) Транскрипция — защита генома путем обнаружения повреждений ДНК. Нат Рев Рак 4: 727–737.
  52. 52. Арима Ю., Нитта М., Кунинака С., Чжан Д., Фудзивара Т. и др.(2005) Транскрипционная блокада индуцирует p53-зависимый апоптоз, связанный с транслокацией p53 в митохондрии. J Biol Chem 280: 19166-19176.
  53. 53. Белоцерковский Б.П., Де Сильва Э., Торналетти С., Ван Г., Васкес К.М. и др. (2007) Образующая триплекс последовательность промотора c-MYC человека препятствует транскрипции ДНК. J Biol Chem 282: 32433–32441.
  54. 54. Дитлевсон Ю.В., Торналетти С., Белоцерковский Б.П., Тейджейро В., Ван Г. и др. (2008) Ингибирующее действие короткой последовательности, образующей Z-ДНК, на удлинение транскрипции с помощью РНК-полимеразы Т7.Nucleic Acids Res 36: 3163-3170.
  55. 55. Grabczyk E, Usdin K (2000) Триплетный повтор GAA * TTC, расширенный при атаксии Фридрейха, препятствует удлинению транскрипции с помощью РНК-полимеразы T7 в зависимости от длины и суперспирали. Nucleic Acids Res 28: 2815–2822.
  56. 56. Парсонс М.А., Синден Р.Р., Избан М.Г. (1998) Транскрипционные свойства РНК-полимеразы II в ДНК, содержащей триплетные повторы, из миотонической дистрофии человека и ломких Х-локусов. J Biol Chem 273: 26998–27008.
  57. 57. Tornaletti S, Park-Snyder S, Hanawalt PC (2008) G4-образующие последовательности в нетранскрибируемой цепи ДНК представляют собой блоки для РНК-полимеразы Т7 и РНК-полимеразы II млекопитающих. J Biol Chem 283: 12756–12762.
  58. 58. Лоулор К.Т., О’Киф Л.В., Самаравира С.Е., ван Эйк С.Л., МакЛеод С.Дж. и др. (2011) Двухцепочечная РНК является патогенной в моделях Drosophila нейродегенеративных заболеваний с расширенными повторениями. Hum Mol Genet 20: 3757–3768.
  59. 59. Osborne RJ, Thornton CA (2006) РНК-доминантные заболевания.Hum Mol Genet 15 Spec № 2: R162–169.

Болезнь петли iPhone 7 — 10 советов, о которых следует помнить

Вы пользователь iPhone 7? Вы когда-нибудь сталкивались с какой-либо проблемой с вашим гаджетом до сих пор? Если нет, то вам очень повезло. В любом случае, остерегайтесь «болезни петли iPhone 7», которая является членом семейства iPhone 6 следующего поколения, которая называется «болезнью прикосновения». Это конкретная техническая проблема, которая, как известно, носит эпидемический характер и может вызывать пользовательские гаджеты iPhone 7 и 7 Plus.Проблема затрагивает аудиораздел вашего устройства, где при совершении звонков вы видите серый значок. В результате человек не сможет слышать вас через наушники или даже через громкоговорители. В то время как звук будет идеальным, если вы подключите свое устройство к динамикам Bluetooth / WiFi во время звонка. Проблему можно решить, обратившись в лучший сервисный центр по ремонту iPhone в Дели, заменив компонент Audio IC, поставляемый с материнской платой iPhone. Проблема возникает именно в неподходящее время, так как у различных пользователей iPhone только заканчивается гарантийный период, и их гаджеты все еще находятся в хорошем состоянии, но их решение довольно дорогое.На данный момент только небольшое количество устройств поражено этим заболеванием, но со временем количество устройств может увеличиваться по мере их старения.
Итак, перейдем к более подробной информации о болезни петли iPhone 7 .

Что такое болезнь петли iPhone 7?

Вы помните проблемы с iPhone 6, которые назвали «болезнью iPhone 6 Touch»? Заболевание петлей названо в честь болезни прикосновения и состоит из набора ошибок, связанных со звуком, которые затрагивают iPhone 7. Несмотря на то, что это ошибка, которая влияет на звуковые функции, она также может приводить к прекращению обычных функций.
Устройство iPhone, которое показывает болезнь петли, будет иметь проблемы с качеством звука, такие как неправильное поведение динамика, необычные звуки и т. Д. Проблемы со звуком iPhone 7 также включают проблемы с микрофоном, телефонные звонки и т. Д., Когда другой человек, участвующий в том же звонке, может не слышать вас . На устройстве отображается кнопка динамика, которая недоступна вместе с приложениями для голосовых заметок. Проблема с динамиком iPhone 7 plus может привести к замедлению работы устройства, зависанию или зависанию при загрузке.

Иск о болезни петли iPhone 7

Apple Insider сообщила, что против Apple был подан коллективный иск из-за дефектов аудио IC на iPhone 7.По словам истцов, в их iPhone 7 обнаружен дефект, известный техническими специалистами как «болезнь петли», и Apple, как полагают, заявила, что ничего не будет с этим делать.

В иске о болезни петли iPhone 7 есть три истца. Двое заявили, что во время звонка у них на сенсорном экране iPhone появилась неактивная кнопка «динамик». Одна из них описала подводный звук во время разговора по телефону, в том смысле, что ей казалось, что звук из телефона звучит так, как вещи звучат для людей под водой.Одна из распространенных жалоб заключалась в том, что Siri не реагировала на голосовые команды, и что другие приложения голосового ответа также были неработоспособны.

В иске заявлено нарушение явной гарантии Apple, нарушение подразумеваемой гарантии, нарушение Закона о гарантии Магнусона-Мосса, нарушение Закона о потребительских гарантиях Сонг-Беверли, нарушение Закона Калифорнии о правовых средствах правовой защиты потребителей, нарушение Закона Калифорнии о недобросовестной конкуренции , нарушение Закона штата Калифорния о ложной рекламе, введение в заблуждение по небрежности и неосновательное обогащение.

Как узнать, что ваше устройство поражено петлей?

Проблемы усугубляются со временем из-за отсоединения микросхемы. В первые дни болезни вы можете иногда сталкиваться с зависанием или серым значком динамика или серым значком голосовой заметки при попытке совершить голосовой вызов. По мере прогрессирования заболевания ваше устройство зависает, не отображая логотип Apple при перезапуске. Поэтому проблема со звуком в iPhone 7 и iPhone 7 plus называется болезнью петли.

Вы можете даже не знать об этой проблеме с вашим iPhone в течение многих дней или даже недель, пока она не достигнет последней стадии с логотипом Apple в «бесконечном цикле». Это проявляется до тех пор, пока не будет выполнена перезагрузка телефона. Это происходит потому, что не все пользователи часто перезагружают или выключают свои телефоны, чтобы проверить, все ли правильно.
«Было обнаружено, что Apple поделилась с поставщиками услуг документом, в котором говорится о проблемах со звуком во время видеочатов в режиме Face-time и телефонных звонков на моделях iPhone 7 и 7 Plus с iOS 11.3 и более поздние версии. К моменту публикации статьи Apple не прислала заявку на комментарий », — цитирует Motherboard.

Симптомы болезни петли iPhone 7

Симптомов болезни петли iPhone 7 немного, но со временем они могут усугубиться. Для начала, вот 5 самых ярких ранних признаков петлевой болезни:

  1. Периодическое зависание телефона
  2. Затененный значок голосовой заметки
  3. Неактивный значок динамика во время телефонных звонков
  4. iPhone периодически перезагружается
  5. iPhone застрял в цикле перезапуска — iPhone постоянно перезагружается, и на экране появляется логотип Apple в течение нескольких секунд, а затем он внезапно исчезает и повторяется снова.

Как возникает болезнь петли iPhone 7?

Утверждается, что аудиочип, отсоединенный от материнской платы, вызывает болезнь петли. Но это всего лишь заявление, и точную причину еще предстоит выяснить. Эксперты предполагают, что причина отслоения стружки может быть из-за коротких падений или из-за непрерывного изгиба, происходящего с течением времени. В таких случаях у тех пользователей, которые носят свой iPhone в кармане, будет петлевое заболевание.

В iPhone 6 болезнь сенсорного управления была вызвана повышенной гибкостью, благодаря которой чип освободился.Еще предстоит определить, является ли болезнь петли iPhone 7 проблемой программного или аппаратного обеспечения. Некоторые пользователи iPhone могут решить проблему, просто сбросив настройки устройства или отрегулировав громкость. Но это может не работать все время, что говорит о том, что это может быть проблема с оборудованием.

Если вы плывете в одной лодке с болезнью петли, попробуйте сначала сбросить настройки устройства или обновить программное обеспечение до последней версии iOS. Если это не работает с вашим устройством, пора отремонтировать.

Причины болезни петли iPhone 7

Точная причина болезни петли iPhone 7 пока не известна, однако считается, что проблема заключается в отсоединении аудиочипа от материнской платы.Некоторые возможные причины болезни петли iPhone 7:

  1. Плохое соединение аккумулятора
  2. Неисправное обновление iOS
  3. Неудачный побег из тюрьмы

Решение для цикла перезагрузки iPhone

  • Принудительный перезапуск. Если это вызвано незначительными сбоями и ошибками программного обеспечения, это может быть ключевым решением. Нажмите и удерживайте кнопку питания и кнопку уменьшения громкости одновременно в течение 20 секунд, чтобы принудительно перезапустить устройство.
  • Обновите iOS до последней доступной версии — перейдите в «Настройки» -> «Основные» -> «Обновление программного обеспечения».Нажмите на опцию Загрузить и установить в случае ожидающего обновления. Другой способ — подключить iPhone 7 к компьютеру и обновить iOS через iTunes.
  • Просматривайте данные аналитики на вашем iPhone 7 — чтобы проверить, не работают ли некорректно приложения. Перейдите в меню Настройки-> Конфиденциальность-> Аналитика-> Аналитические данные. Проверяйте наличие проблемных приложений в списке снова и снова. Удалите это приложение, чтобы проверить, устранена ли проблема.

Для более серьезных ошибок попробуйте два решения ниже. Однако рекомендуется сделать резервную копию всех необходимых внутренних данных и информации, поскольку эти решения удаляют все важные данные, включая личную информацию.

  • Восстановление iOS в режиме восстановления с помощью iTunes. Для начала войдите в режим восстановления и выберите вариант восстановления iOS. Выберите восстановление вашего устройства до предыдущей и стабильной резервной копии iOS и iPhone до заводских настроек по умолчанию. Это может решить или не решить проблему, так как с некоторыми проблемами петли справиться сложнее, и они могут сохраняться даже после процедуры.
  • Восстановите свой iPhone 7 в режиме DFU с помощью iTunes. Восстановление в режиме обновления прошивки устройства считается самым глубоким типом восстановления, которое можно выполнить на iPhone.Вам нужно будет использовать iTunes на компьютере для выполнения этого восстановления.

Прочие опции

  • Используйте все доступные программы для восстановления iOS, чтобы попытаться решить эту проблему. Растущее число жалоб на эти сложные проблемы с программным обеспечением привело к появлению множества инструментов для восстановления и исправления, разрабатываемых программными компаниями и разработчиками. Успех может быть, а может и не быть, но какой вред в попытках.
  • Извлеките и повторно вставьте SIM-карту, что может быть проблемой. Проблема между соединением телефона и оператором беспроводной связи может привести к зависанию телефона в цикле перезапуска.Попробуйте вынуть и снова вставить SIM-карту или полностью заменить ее.
  • Оплатите обслуживание в сервисном центре Apple или воспользуйтесь гарантией, если она еще действительна. Системный сбой, связанный с предустановленными приложениями и услугами, не может быть исправлен большинством методов. Лучшее, что вы можете сделать — это пойти в центр Apple.

У некоторых пользователей возникает цикл перезапуска iPhone для iPhone XR, iPhone XS (Max) или других моделей. Это произошло при запуске iOS 12. При обновлении до более новой версии пользователи столкнулись с проблемой цикла перезапуска iPhone 7 из-за плохого обновления или вредоносного ПО.В таких случаях будет отображаться логотип Apple, а затем перезагрузите устройство, не загружая его. Это будет повторяться снова и снова, чтобы сформировать цикл загрузки iPhone. Если вы столкнулись с зацикливанием при загрузке iPhone 7, не беспокойтесь, одновременно нажмите и удерживайте кнопку уменьшения громкости и кнопку сна, чтобы принудительно перезагрузить устройство. Если проблема не исчезнет, ​​попробуйте отремонтировать устройство в лучшем сервисном центре.

Загрузочная петля iPhone 7 после замены экрана

Иногда замена экрана iPhone может завершаться циклом загрузки.Если ремонт производится самостоятельно, возможно, вы не знаете, в чем проблема. Есть набор параметров, которым гаджеты Apple следуют при загрузке. Таким образом, если в системе есть неисправное оборудование, это заставляет устройство перезагружаться снова и снова, образуя цикл загрузки. После этого устройство никогда не перезагрузится само по себе. Если проблема проста, вы можете легко исправить и начать использовать свой iPhone как обычно. В противном случае придется обращаться в хороший сервисный центр.

«Не беспокойтесь, если у вас возникнут проблемы, похожие на болезнь петли или загрузочную петлю, поскольку Apple знает об этой проблеме, и покупатель может напрямую связаться с Apple Care, если в случае необходимости каких-либо разъяснений», — прокомментировал представитель Apple.

Rapid Repair предлагает услуги на пороге для решения всех проблем, связанных с iPhone, в Дели / NCR и его окрестностях. Наши опытные специалисты диагностируют проблему на ранней стадии и неустанно работают, чтобы вернуть вам полностью функциональный телефон в кратчайшие сроки. Мы также передадим вам запасной телефон, чтобы вы не пропустили важные обновления. Болезнь петли iPhone 7 — одна из таких областей, в которой мы обладаем опытом и можем помочь вам решить проблему, если ничего из вышеперечисленного не помогло.

Итак, у вас была петлевая болезнь? Давайте обсудим этот опыт сейчас!

.

Добавить комментарий

Ваш адрес email не будет опубликован.